|
miRBase |
|
Stem-loop sequence hsa-mir-514b |
||||||||
| Accession | MI0014251 | |||||||
| Description | Homo sapiens miR-514b stem-loop | |||||||
| Gene family | MIPF0000130; mir-506 | |||||||
| Stem-loop |
g u - gagg g a caugug uacucu cuca agagg caaucaugu u a |||||| |||||| |||| ||||| ||||||||| | guacac augagg gagu ucucc guuaguaua a u a u g -aca g u |
|||||||
| Deep sequencing |
| |||||||
| Genome context |
|
|||||||
| Clustered miRNAs |
|
|||||||
| Database links |
|
|||||||
Mature sequence hsa-miR-514b-5p |
|
| Accession | MIMAT0015087 |
| Sequence |
13 - uucucaagagggaggcaaucau - 34 |
| Deep sequencing | 254 reads, 8 experiments |
| Evidence | experimental; Solexa [1-4] |
| Predicted targets |
|
Mature sequence hsa-miR-514b-3p |
|
| Accession | MIMAT0015088 |
| Sequence |
50 - auugacaccucugugagugga - 70 |
| Deep sequencing | 1310 reads, 9 experiments |
| Evidence | experimental; Solexa [1,3-4] |
| Predicted targets |
|
References |
|
| 1 |
PMID:20300190
"Characterization of the Melanoma miRNAome by Deep Sequencing"
PLoS One. 5:e9685(2010).
|
| 2 |
PMID:20224791
"Discovery of novel microRNAs in female reproductive tract using next generation sequencing"
PLoS One. 5:e9637(2010).
|
| 3 | |
| 4 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|