Stem-loop sequence hsa-mir-548x

Accession MI0014244
Description Homo sapiens miR-548x stem-loop
Gene family MIPF0000317; mir-548
Stem-loop 
     a   ca                     uuac 
agguu gug  aaaguaauugcaguuuuugcg    u
||||| |||  |||||||||||||||||||||    u
ucuaa cac  uuucauuaacgucaaaaaugc    u
     c   ac                     uaac
Get sequence
Deep sequencing
28 reads, 7 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr21: 20058408-20058482 [-]
sense
OTTHUMT00000158276 ; AL109763.2-001; intron 2
OTTHUMT00000158278 ; AL109763.2-003; intron 2
OTTHUMT00000158276 ; AL109763.2-001; intron 2
OTTHUMT00000158278 ; AL109763.2-003; intron 2
OTTHUMT00000158276 ; AL109763.2-001; intron 2
OTTHUMT00000158278 ; AL109763.2-003; intron 2
OTTHUMT00000158277 ; AL109763.2-002; intron 3
OTTHUMT00000158277 ; AL109763.2-002; intron 3
OTTHUMT00000158277 ; AL109763.2-002; intron 3
ENST00000437492 ; AL109763.2-001; intron 2
ENST00000414582 ; AL109763.2-003; intron 2
ENST00000437492 ; AL109763.2-001; intron 2
ENST00000414582 ; AL109763.2-003; intron 2
ENST00000437492 ; AL109763.2-001; intron 2
ENST00000414582 ; AL109763.2-003; intron 2
ENST00000355189 ; AL109763.2-002; intron 3
ENST00000355189 ; AL109763.2-002; intron 3
ENST00000355189 ; AL109763.2-002; intron 3
Database links

Mature sequence hsa-miR-548x-5p

Accession MIMAT0022733
Sequence

8 -  

ugcaaaaguaauugcaguuuuug

 - 30

Get sequence
Deep sequencing 10 reads, 5 experiments
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-548x-3p

Accession MIMAT0015081
Previous IDs hsa-miR-548x
Sequence

46 -  

uaaaaacugcaauuacuuuc

 - 65

Get sequence
Deep sequencing 19 reads, 4 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).