|
miRBase |
|
Stem-loop sequence hsa-mir-3192 |
|||||
| Accession | MI0014237 | ||||
| Description | Homo sapiens miR-3192 stem-loop | ||||
| Gene family | MIPF0001597; mir-3192 | ||||
| Stem-loop |
--uu u uag u a u ggaaggga cugggagg ug cag ggaa aag u |||||||| |||||||| || ||| |||| ||| ucuuccuu gacucucc gc guc ccuu uuu c ucuc c -ua u c u |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-3192 |
|
| Accession | MIMAT0015076 |
| Sequence |
10 - ucugggagguuguagcaguggaa - 32 |
| Deep sequencing | 85 reads, 10 experiments |
| Evidence | experimental; Solexa [1-2] |
| Predicted targets |
|
References |
|
| 1 |
PMID:20300190
"Characterization of the Melanoma miRNAome by Deep Sequencing"
PLoS One. 5:e9685(2010).
|
| 2 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|