Stem-loop sequence hsa-mir-3188

AccessionMI0014232 (change log)
Symbol HGNC:MIR3188
DescriptionHomo sapiens miR-3188 stem-loop
Gene family MIPF0001488; mir-3188
Literature search

2 open access papers mention hsa-mir-3188
(3 sentences)

Stem-loop
   ggc      u      c   g    -         cc    cgc 
5'    gccucc gcucug ugu ccgc cagggccuc  cuag   g
      |||||| |||||| ||| |||| |||||||||  ||||    
3'    cggagg cggggc aua ggcg guuucggag  gguc   c
   -uc      u      -   -    u         -a    uuc 
Get sequence
Deep sequencing
372 reads, 1.28 reads per million, 78 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 18282077-18282161 [+]
sense
OTTHUMT00000466386 ; AC007192.4-001; intron 16
ENST00000593731 ; PIK3R2-001; intron 16
Database links

Mature sequence hsa-miR-3188

Accession MIMAT0015070
Sequence

53 - 

agaggcuuugugcggauacgggg

 - 75

Get sequence
Deep sequencing340 reads, 67 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).