Stem-loop sequence hsa-mir-3187

Accession MI0014231
Description Homo sapiens miR-3187 stem-loop
Stem-loop 
          g     -gu      g    ucacc 
gcuggcccug gcagc   guggcu aagg     a
|||||||||| |||||   |||||| ||||      
cgaccggggc cgucg   uaccgg uucc     u
          g     ggg      -    ucuug
Get sequence
Deep sequencing
92 reads, 12 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr19: 813584-813653 [+]
antisense
OTTHUMT00000379097 ; LPPR3-002; exon 7
OTTHUMT00000379097 ; LPPR3-002; exon 7
OTTHUMT00000379097 ; LPPR3-002; exon 7
OTTHUMT00000379096 ; LPPR3-001; exon 8
OTTHUMT00000379096 ; LPPR3-001; exon 8
OTTHUMT00000379096 ; LPPR3-001; exon 8
ENST00000359894 ; AC006273.1-002; exon 7
ENST00000359894 ; LPPR3-002; exon 7
ENST00000359894 ; hsa-mir-3187.1-002; exon 7
ENST00000300947 ; AC006273.1-201; exon 8
ENST00000520876 ; AC006273.1-001; exon 8
ENST00000520876 ; LPPR3-001; exon 8
ENST00000300947 ; LPPR3-201; exon 8
ENST00000520876 ; hsa-mir-3187.1-001; exon 8
Clustered miRNAs
< 10kb from hsa-mir-3187
hsa-mir-4745 chr19: 804940-805001 [+]
hsa-mir-3187 chr19: 813584-813653 [+]
Database links

Mature sequence hsa-miR-3187-5p

Accession MIMAT0019216
Sequence

7 -  

ccugggcagcguguggcugaagg

 - 29

Get sequence
Deep sequencing 10 reads, 5 experiments
Evidence experimental; Solexa [2]
Predicted targets

Mature sequence hsa-miR-3187-3p

Accession MIMAT0015069
Previous IDs hsa-miR-3187
Sequence

44 -  

uuggccauggggcugcgcgg

 - 63

Get sequence
Deep sequencing 82 reads, 8 experiments
Evidence experimental; Solexa [1-2]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).