Stem-loop sequence hsa-mir-3156-2

AccessionMI0014230 (change log)
Symbol HGNC:MIR3156-2
DescriptionHomo sapiens miR-3156-2 stem-loop
Gene family MIPF0000891; mir-3156
Literature search

3 open access papers mention hsa-mir-3156-2
(9 sentences)

         -                     a    uucac 
5' ugcaga agaaagaucuggaagugggag cacu     u
   |||||| ||||||||||||||||||||| ||||      
3' augucu ucuuucuagaccuucacccuc guga     a
         c                     g    uauau 
Get sequence
Deep sequencing
104 reads, 0 reads per million, 34 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr18: 14830166-14830242 [+]
OTTHUMT00000443557 ; ANKRD30B-001; intron 27
ENST00000581101 ; MIR3156-2-201; exon 1
ENST00000358984 ; ANKRD30B-001; intron 27
Database links

Mature sequence hsa-miR-3156-5p

Accession MIMAT0015030
Previous IDshsa-miR-3156

9 - 


 - 30

Get sequence
Deep sequencing237 reads, 18 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

Mature sequence hsa-miR-3156-3p

Accession MIMAT0019209

50 - 


 - 70

Get sequence
Deep sequencing48 reads, 19 experiments
Evidence experimental; Illumina [2]
Predicted targets


PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).