Stem-loop sequence hsa-mir-3065

Accession MI0014228
Description Homo sapiens miR-3065 stem-loop
Gene family MIPF0001105; mir-3065
Stem-loop 
   c            a   a   a     ------  g  g 
cug ccucuucaacaa auc cug ugcug      ga uc c
||| |||||||||||| ||| ||| |||||      || ||  
gac ggagagguuguu uag gac acgac      cu ag c
   a            a   -   c     ucacua  g  u
Get sequence
Deep sequencing
85 reads, 13 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr17: 79099677-79099755 [+]
antisense
OTTHUMT00000439039 ; AATK-009; intron 1
OTTHUMT00000439039 ; AATK-009; intron 1
OTTHUMT00000439041 ; AATK-008; intron 5
OTTHUMT00000439041 ; AATK-008; intron 5
OTTHUMT00000256056 ; AATK-002; intron 6
OTTHUMT00000256056 ; AATK-002; intron 6
OTTHUMT00000256056 ; AATK-002; intron 6
OTTHUMT00000256055 ; AATK-001; intron 7
OTTHUMT00000256055 ; AATK-001; intron 7
OTTHUMT00000439038 ; AATK-004; intron 7
OTTHUMT00000256055 ; AATK-001; intron 7
OTTHUMT00000439038 ; AATK-004; intron 7
ENST00000573469 ; AATK-009; intron 1
ENST00000573469 ; AATK-009; intron 1
ENST00000572339 ; AATK-008; intron 5
ENST00000572339 ; AATK-008; intron 5
ENST00000417379 ; AATK-002; intron 6
ENST00000417379 ; AATK-002; intron 6
ENST00000417379 ; AATK-002; intron 6
ENST00000326724 ; AATK-001; intron 7
ENST00000374792 ; AATK-201; intron 7
ENST00000326724 ; AATK-001; intron 7
ENST00000374792 ; AATK-004; intron 7
ENST00000326724 ; AATK-001; intron 7
ENST00000374792 ; AATK-004; intron 7
Clustered miRNAs
< 10kb from hsa-mir-3065
hsa-mir-657 chr17: 79099076-79099173 [-]
hsa-mir-3065 chr17: 79099677-79099755 [+]
hsa-mir-338 chr17: 79099683-79099749 [-]
hsa-mir-1250 chr17: 79106996-79107108 [-]
Database links

Mature sequence hsa-miR-3065-5p

Accession MIMAT0015066
Sequence

10 -  

ucaacaaaaucacugaugcugga

 - 32

Get sequence
Deep sequencing 41 reads, 8 experiments
Evidence experimental; Solexa [1,3], 454 [2]
Predicted targets

Mature sequence hsa-miR-3065-3p

Accession MIMAT0015378
Sequence

50 -  

ucagcaccaggauauuguuggag

 - 72

Get sequence
Deep sequencing 44 reads, 11 experiments
Evidence experimental; Solexa [1,3], 454 [2]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:20483914 "Discovery of microRNAs and other small RNAs in solid tumors" Meiri E, Levy A, Benjamin H, Ben-David M, Cohen L, Dov A, Dromi N, Elyakim E, Yerushalmi N, Zion O, Lithwick-Yanai G, Sitbon E Nucleic Acids Res. 38:6234-6246(2010).
3
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).