Stem-loop sequence hsa-mir-3183

Accession

MI0014225

Description

Homo sapiens miR-3183 stem-loop

Stem-loop

       -  g        --    u   u     cag  a  u 
cucugcc cu ccucucuc  ggag cgc cggag   uc cg u
||||||| || ||||||||  |||| ||| |||||   || ||  
gggacgg ga ggagggag  ccuc gcg gccuc   ag gc g
       a  -        cu    c   -     cua  -  a 

Deep sequencing

19 reads, 5 experiments

Genome context

• Coordinates (GRCh37.p5): chr17: 925716-925799 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000437260 ; ABR-014; intron 1

  OTTHUMT00000437253 ; ABR-005; intron 1

  OTTHUMT00000437264 ; ABR-019; intron 1

  OTTHUMT00000437265 ; ABR-015; intron 1

  OTTHUMT00000437258 ; ABR-009; intron 1

  OTTHUMT00000437266 ; ABR-016; intron 1

  OTTHUMT00000437260 ; ABR-014; intron 1

  OTTHUMT00000437253 ; ABR-005; intron 1

  OTTHUMT00000437264 ; ABR-019; intron 1

  OTTHUMT00000437265 ; ABR-015; intron 1

  OTTHUMT00000437258 ; ABR-009; intron 1

  OTTHUMT00000437266 ; ABR-016; intron 1

  OTTHUMT00000437257 ; ABR-008; intron 2

  OTTHUMT00000437257 ; ABR-008; intron 2

  OTTHUMT00000437273 ; ABR-026; intron 11

  OTTHUMT00000437273 ; ABR-026; intron 11

  OTTHUMT00000437248 ; ABR-002; intron 15

  OTTHUMT00000437249 ; ABR-003; intron 15

  OTTHUMT00000437248 ; ABR-002; intron 15

  OTTHUMT00000437249 ; ABR-003; intron 15

  OTTHUMT00000206675 ; ABR-001; intron 16

  OTTHUMT00000206675 ; ABR-001; intron 16

  OTTHUMT00000437250 ; ABR-004; intron 16

  OTTHUMT00000206675 ; ABR-001; intron 16

  OTTHUMT00000437250 ; ABR-004; intron 16

  ENST00000543210 ; ABR-204; intron 1

  ENST00000572441 ; ABR-014; intron 1

  ENST00000543210 ; ABR-005; intron 1

  ENST00000571022 ; ABR-019; intron 1

  ENST00000577052 ; ABR-015; intron 1

  ENST00000574257 ; ABR-009; intron 1

  ENST00000576668 ; ABR-016; intron 1

  ENST00000572441 ; ABR-014; intron 1

  ENST00000543210 ; ABR-005; intron 1

  ENST00000571022 ; ABR-019; intron 1

  ENST00000577052 ; ABR-015; intron 1

  ENST00000574257 ; ABR-009; intron 1

  ENST00000576668 ; ABR-016; intron 1

  ENST00000572152 ; ABR-008; intron 2

  ENST00000572152 ; ABR-008; intron 2

  ENST00000382259 ; ABR-202; intron 10

  ENST00000382259 ; ABR-201; intron 10

  ENST00000536794 ; ABR-203; intron 11

  ENST00000536794 ; ABR-026; intron 11

  ENST00000536794 ; ABR-026; intron 11

  ENST00000291107 ; ABR-201; intron 15

  ENST00000574437 ; ABR-002; intron 15

  ENST00000291107 ; ABR-003; intron 15

  ENST00000574437 ; ABR-002; intron 15

  ENST00000291107 ; ABR-003; intron 15

  ENST00000302538 ; ABR-001; intron 16

  ENST00000544583 ; ABR-205; intron 16

  ENST00000302538 ; ABR-001; intron 16

  ENST00000544583 ; ABR-004; intron 16

  ENST00000302538 ; ABR-001; intron 16

  ENST00000544583 ; ABR-004; intron 16

Database links

• ENTREZGENE: 100422835;MIR3183

Mature sequence hsa-miR-3183

• Accession: MIMAT0015063
• Sequence: 10 - gccucucucggagucgcucgga - 31
• Deep sequencing: 19 reads, 5 experiments
• Evidence: experimental; Solexa [1-3]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-3183
  • MICRORNA.ORG:hsa-miR-3183
  • MIRDB:hsa-miR-3183
  • RNA22-HSA:hsa-miR-3183
  • TARGETMINER:hsa-miR-3183

References

1. PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
3. PMID:21606961 "Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia" Schotte D, Moqadam FA, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML Leukemia. 25:1389-1399(2011).