![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-3183 |
|||||
Accession | MI0014225 (change log) | ||||
Symbol | HGNC:MIR3183 | ||||
Description | Homo sapiens miR-3183 stem-loop | ||||
Stem-loop |
- g -- u u cag a u 5' cucugcc cu ccucucuc ggag cgc cggag uc cg u ||||||| || |||||||| |||| ||| ||||| || || 3' gggacgg ga ggagggag ccuc gcg gccuc ag gc g a - cu c - cua - a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-3183 |
|
Accession | MIMAT0015063 |
Sequence |
10 - gccucucucggagucgcucgga - 31 |
Deep sequencing | 90 reads, 27 experiments |
Evidence | experimental; Illumina [1-3] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:20300190
"Characterization of the Melanoma miRNAome by Deep Sequencing"
PLoS One. 5:e9685(2010).
|
2 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|
3 |
PMID:21606961
"Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia"
Leukemia. 25:1389-1399(2011).
|