Stem-loop sequence hsa-mir-548w

Accession MI0014222
Description Homo sapiens miR-548w stem-loop
Gene family MIPF0000317; mir-548
Stem-loop
                 c  c  u       uuuca 
gguuggugcaaaaguaa ug gg uuuugcc     a
||||||||||||||||| || || |||||||      
cuaaccacguuuucauu ac cc aaaacgg     c
                 a  a  c       uaaua 
Get sequence
Deep sequencing
52 reads, 19 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr16: 26036558-26036631 [+]
sense
OTTHUMT00000133286 ; HS3ST4-001; intron 1
OTTHUMT00000276993 ; HS3ST4-002; intron 1
OTTHUMT00000133286 ; HS3ST4-001; intron 1
OTTHUMT00000276993 ; HS3ST4-002; intron 1
OTTHUMT00000133286 ; HS3ST4-001; intron 1
OTTHUMT00000276993 ; HS3ST4-002; intron 1
ENST00000331351 ; HS3ST4-001; intron 1
ENST00000475436 ; HS3ST4-002; intron 1
ENST00000331351 ; HS3ST4-001; intron 1
ENST00000475436 ; HS3ST4-002; intron 1
ENST00000331351 ; HS3ST4-001; intron 1
ENST00000475436 ; HS3ST4-002; intron 1
Database links

Mature sequence hsa-miR-548w

Accession MIMAT0015060
Sequence

10 - 

aaaaguaacugcgguuuuugccu

 - 32

Get sequence
Deep sequencing 28 reads, 11 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).