Stem-loop sequence hsa-mir-3180-3

AccessionMI0014217 (change log)
Symbol HGNC:MIR3180-3
DescriptionHomo sapiens miR-3180-3 stem-loop
Gene family MIPF0000894; mir-3180
Literature search

6 open access papers mention hsa-mir-3180-3
(58 sentences)

Stem-loop
   cagu   ac      a      a  c              ----------  c 
5'     gcg  gggcgg gcuucc ga gcuccgccccacgu          cg a
       |||  |||||| |||||| || ||||||||||||||          ||  
3'     cgu  cccgcc cggagg cu cgaggcggggugcg          gc u
   --gu   --      c      c  u              aaagggcccc  g 
Get sequence
Deep sequencing
5074 reads, 13.8 reads per million, 87 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 18402178-18402271 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-3180-3
hsa-mir-3179-3chr16: 18411894-18411977 [-]
hsa-mir-3670-3chr16: 18405698-18405762 [-]
hsa-mir-3180-3chr16: 18402178-18402271 [-]
Database links

Mature sequence hsa-miR-3180-5p

Accession MIMAT0015057
Sequence

18 - 

cuuccagacgcuccgccccacgucg

 - 42

Get sequence
Deep sequencing1167 reads, 46 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-3180-3p

Accession MIMAT0015058
Sequence

62 - 

uggggcggagcuuccggaggcc

 - 83

Get sequence
Deep sequencing14034 reads, 62 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).