|
miRBase |
|
Stem-loop sequence hsa-mir-3179-2 |
||||||||
| Accession | MI0014216 | |||||||
| Description | Homo sapiens miR-3179-2 stem-loop | |||||||
| Gene family | MIPF0000900; mir-3179 | |||||||
| Stem-loop |
a gcc caggaucacagacguuuaaauu cacuccuucugcugu u |||||||||||||||||||||| ||||||||||||||| guccuagugucugcaaauuuaa guggggaagaugacg u a aca |
|||||||
| Deep sequencing |
| |||||||
| Genome context |
|
|||||||
| Clustered miRNAs |
|
|||||||
| Database links |
|
|||||||
Mature sequence hsa-miR-3179 |
|
| Accession | MIMAT0015056 |
| Sequence |
52 - agaaggggugaaauuuaaacgu - 73 |
| Deep sequencing | 66 reads, 3 experiments |
| Evidence | experimental; Solexa [1-3] |
| Predicted targets |
|
References |
|
| 1 |
PMID:20300190
"Characterization of the Melanoma miRNAome by Deep Sequencing"
PLoS One. 5:e9685(2010).
|
| 2 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|