Stem-loop sequence hsa-mir-3180-2

AccessionMI0014215 (change log)
Symbol HGNC:MIR3180-2
DescriptionHomo sapiens miR-3180-2 stem-loop
Gene family MIPF0000894; mir-3180
Literature search

6 open access papers mention hsa-mir-3180-2
(58 sentences)

Stem-loop
   gcgac      a      a  c              ----------  c 
5'      gggcgg gcuucc ga gcuccgccccacgu          cg a
        |||||| |||||| || ||||||||||||||          ||  
3'      cccgcc cggagg cu cgaggcggggugcg          gc u
   --cgu      c      c  u              aaagggcccc  g 
Get sequence
Deep sequencing
5073 reads, 13.8 reads per million, 87 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 16309879-16309966 [+]
antisense
OTTHUMT00000252232 ; ABCC6-001; intron 4
OTTHUMT00000436243 ; ABCC6-003; intron 4
OTTHUMT00000436244 ; ABCC6-002; intron 4
OTTHUMT00000436245 ; ABCC6-007; intron 5
ENST00000205557 ; ABCC6-001; intron 4
ENST00000456970 ; ABCC6-003; intron 4
ENST00000574094 ; ABCC6-002; intron 4
ENST00000577103 ; ABCC6-007; intron 5
Clustered miRNAs
< 10kb from hsa-mir-3180-2
hsa-mir-3179-2chr16: 16300159-16300242 [+]
hsa-mir-3670-2chr16: 16306370-16306434 [+]
hsa-mir-3180-2chr16: 16309879-16309966 [+]
Database links

Mature sequence hsa-miR-3180-5p

Accession MIMAT0015057
Sequence

14 - 

cuuccagacgcuccgccccacgucg

 - 38

Get sequence
Deep sequencing1167 reads, 46 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-3180-3p

Accession MIMAT0015058
Sequence

58 - 

uggggcggagcuuccggaggcc

 - 79

Get sequence
Deep sequencing14034 reads, 62 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).