Stem-loop sequence hsa-mir-3177

Accession MI0014211
Description Homo sapiens miR-3177 stem-loop
Stem-loop 
   c           aca  c     ag       cu      
cca gugccaugugu   ca gugcc  gcgcugu  ugaga 
||| |||||||||||   || |||||  |||||||  |||| c
ggu cacggugcaca   gu cacgg  cgugacg  gcuua 
   -           ggg  -     ca       -c
Get sequence
Deep sequencing
38 reads, 8 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr16: 1784986-1785067 [+]
sense
OTTHUMT00000250508 ; MAPK8IP3-001; intron 4
OTTHUMT00000250508 ; MAPK8IP3-001; intron 4
OTTHUMT00000433168 ; MAPK8IP3-007; intron 4
OTTHUMT00000433169 ; MAPK8IP3-002; intron 4
OTTHUMT00000433170 ; MAPK8IP3-003; intron 4
OTTHUMT00000250508 ; MAPK8IP3-001; intron 4
OTTHUMT00000433168 ; MAPK8IP3-007; intron 4
OTTHUMT00000433169 ; MAPK8IP3-002; intron 4
OTTHUMT00000433170 ; MAPK8IP3-003; intron 4
ENST00000250894 ; MAPK8IP3-001; intron 4
ENST00000356010 ; MAPK8IP3-201; intron 4
ENST00000250894 ; MAPK8IP3-001; intron 4
ENST00000356010 ; MAPK8IP3-007; intron 4
ENST00000564098 ; MAPK8IP3-002; intron 4
ENST00000561765 ; MAPK8IP3-003; intron 4
ENST00000250894 ; MAPK8IP3-001; intron 4
ENST00000356010 ; MAPK8IP3-007; intron 4
ENST00000564098 ; MAPK8IP3-002; intron 4
ENST00000561765 ; MAPK8IP3-003; intron 4
Database links

Mature sequence hsa-miR-3177-5p

Accession MIMAT0019215
Sequence

11 -  

uguguacacacgugccaggcgcu

 - 33

Get sequence
Evidence experimental; Solexa [2-3]
Predicted targets

Mature sequence hsa-miR-3177-3p

Accession MIMAT0015054
Previous IDs hsa-miR-3177
Sequence

54 -  

ugcacggcacuggggacacgu

 - 74

Get sequence
Deep sequencing 38 reads, 8 experiments
Evidence experimental; Solexa [1-3]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
3
PMID:21606961 "Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia" Schotte D, Moqadam FA, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML Leukemia. 25:1389-1399(2011).