Stem-loop sequence hsa-mir-3175

Accession MI0014209
Description Homo sapiens miR-3175 stem-loop
Stem-loop 
      --   c         a   ag      cug  c 
ccuggg  ggg ggggagaga cgc  ugacgu   gc g
||||||  ||| ||||||||| |||  ||||||   || c
ggaccc  ccc cuccucuuu gcg  gcugua   cg g
      au   c         c   -g      -cg  u
Get sequence
Deep sequencing
100 reads, 16 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr15: 93447629-93447705 [+]
sense
OTTHUMT00000415080 ; CHD2-008; 3'UTR (exon 1)
OTTHUMT00000415080 ; CHD2-008; 3'UTR (exon 1)
OTTHUMT00000313528 ; CHD2-001; intron 2
OTTHUMT00000415075 ; CHD2-003; intron 2
OTTHUMT00000415076 ; CHD2-004; intron 2
OTTHUMT00000415078 ; CHD2-005; intron 2
OTTHUMT00000313528 ; CHD2-001; intron 2
OTTHUMT00000415075 ; CHD2-003; intron 2
OTTHUMT00000415076 ; CHD2-004; intron 2
OTTHUMT00000415078 ; CHD2-005; intron 2
OTTHUMT00000313528 ; CHD2-001; intron 2
OTTHUMT00000415075 ; CHD2-003; intron 2
OTTHUMT00000415076 ; CHD2-004; intron 2
OTTHUMT00000415078 ; CHD2-005; intron 2
OTTHUMT00000415073 ; CHD2-007; intron 3
OTTHUMT00000415073 ; CHD2-007; intron 3
OTTHUMT00000415073 ; CHD2-007; intron 3
OTTHUMT00000415070 ; CHD2-013; intron 5
OTTHUMT00000415070 ; CHD2-013; intron 5
OTTHUMT00000415070 ; CHD2-013; intron 5
ENST00000536619 ; CHD2-008; 3'UTR (exon 1)
ENST00000536619 ; CHD2-008; 3'UTR (exon 1)
ENST00000394196 ; CHD2-001; intron 2
ENST00000557381 ; CHD2-003; intron 2
ENST00000309818 ; CHD2-004; intron 2
ENST00000420239 ; CHD2-005; intron 2
ENST00000394196 ; CHD2-001; intron 2
ENST00000557381 ; CHD2-003; intron 2
ENST00000309818 ; CHD2-004; intron 2
ENST00000420239 ; CHD2-005; intron 2
ENST00000394196 ; CHD2-001; intron 2
ENST00000557381 ; CHD2-003; intron 2
ENST00000309818 ; CHD2-004; intron 2
ENST00000420239 ; CHD2-005; intron 2
ENST00000556930 ; CHD2-007; intron 3
ENST00000556930 ; CHD2-007; intron 3
ENST00000556930 ; CHD2-007; intron 3
ENST00000556722 ; CHD2-013; intron 5
ENST00000556722 ; CHD2-013; intron 5
ENST00000556722 ; CHD2-013; intron 5
Database links

Mature sequence hsa-miR-3175

Accession MIMAT0015052
Sequence

10 -  

cggggagagaacgcagugacgu

 - 31

Get sequence
Deep sequencing 99 reads, 15 experiments
Evidence experimental; Solexa [1-3]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
3
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).