Stem-loop sequence hsa-mir-3118-4

AccessionMI0014207 (change log)
Symbol HGNC:MIR3118-4
DescriptionHomo sapiens miR-3118-4 stem-loop
Literature search

3 open access papers mention hsa-mir-3118-4
(6 sentences)

Stem-loop
          c  u               a      aca 
5' cauacua aa aauuuucauaaugca ucacac   a
   ||||||| || ||||||||||||||| ||||||   u
3' gugugau uu uuaaaaguauuacgu agugug   c
          c  c               c      cca 
Get sequence
Deep sequencing
65 reads, 0 reads per million, 28 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 21843750-21843824 [+]
intergenic
Database links

Mature sequence hsa-miR-3118

Accession MIMAT0014980
Sequence

44 - 

ugugacugcauuaugaaaauucu

 - 66

Get sequence
Deep sequencing344 reads, 26 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).