Stem-loop sequence hsa-mir-323b

AccessionMI0014206 (change log)
Symbol HGNC:MIR323B
DescriptionHomo sapiens miR-323b stem-loop
Gene family MIPF0000018; mir-154
Literature search

47 open access papers mention hsa-mir-323b
(109 sentences)

Stem-loop
   u     u             u     gugaguuc         
5'  gguac cggagggagguug ccgug        gcauuauu 
    ||||| ||||||||||||| |||||        ||||||| u
3'  cuaug gcuuuucuccagc ggcac        cguaguaa 
   a     -             u     --auaacc         
Get sequence
Deep sequencing
691 reads, 0 reads per million, 92 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

miR-323b-5p was previously named miR-453 here and in [1,2], but appears to be processed from the same hairpin as miR-332b-3p identified in [3]. Entries for mir-323b and mir-453 are merged here.

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 101056219-101056300 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-323b
hsa-mir-487bchr14: 101046455-101046538 [+]
hsa-mir-539chr14: 101047321-101047398 [+]
hsa-mir-889chr14: 101047901-101047979 [+]
hsa-mir-544achr14: 101048658-101048748 [+]
hsa-mir-655chr14: 101049550-101049646 [+]
hsa-mir-487achr14: 101052446-101052525 [+]
hsa-mir-382chr14: 101054306-101054381 [+]
hsa-mir-134chr14: 101054687-101054759 [+]
hsa-mir-668chr14: 101055258-101055323 [+]
hsa-mir-485chr14: 101055419-101055491 [+]
hsa-mir-323bchr14: 101056219-101056300 [+]
hsa-mir-154chr14: 101059755-101059838 [+]
hsa-mir-496chr14: 101060573-101060674 [+]
hsa-mir-377chr14: 101062050-101062118 [+]
hsa-mir-541chr14: 101064495-101064578 [+]
hsa-mir-409chr14: 101065300-101065378 [+]
hsa-mir-412chr14: 101065447-101065537 [+]
hsa-mir-369chr14: 101065598-101065667 [+]
hsa-mir-410chr14: 101065912-101065991 [+]
Database links

Mature sequence hsa-miR-323b-5p

Accession MIMAT0001630
Previous IDshsa-miR-453
Sequence

15 - 

agguuguccguggugaguucgca

 - 37

Get sequence
Deep sequencing26 reads, 9 experiments
Evidence experimental; cloned [1-2]
Predicted targets

Mature sequence hsa-miR-323b-3p

Accession MIMAT0015050
Sequence

51 - 

cccaauacacggucgaccucuu

 - 72

Get sequence
Deep sequencing665 reads, 91 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

References

1
PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).