Stem-loop sequence hsa-mir-3173

Accession MI0014204
Description Homo sapiens miR-3173 stem-loop
Gene family MIPF0001383; mir-3173
Stem-loop 
      c                     ga  u 
ucccug ccugccuguuuucuccuuugu  uu u
|||||| |||||||||||||||||||||  ||  
agggac ggacggauaaaggaggaaaca  ag a
      c                     ag  u
Get sequence
Deep sequencing
20 reads, 8 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr14: 95604256-95604323 [-]
sense
OTTHUMT00000387996 ; DICER1-001; intron 1
OTTHUMT00000388004 ; DICER1-005; intron 1
OTTHUMT00000388007 ; DICER1-007; intron 1
OTTHUMT00000387996 ; DICER1-001; intron 1
OTTHUMT00000388004 ; DICER1-005; intron 1
OTTHUMT00000388007 ; DICER1-007; intron 1
OTTHUMT00000387996 ; DICER1-001; intron 1
OTTHUMT00000388004 ; DICER1-005; intron 1
OTTHUMT00000388007 ; DICER1-007; intron 1
OTTHUMT00000387997 ; DICER1-004; intron 3
OTTHUMT00000388005 ; DICER1-002; intron 3
OTTHUMT00000387997 ; DICER1-004; intron 3
OTTHUMT00000388005 ; DICER1-002; intron 3
OTTHUMT00000387997 ; DICER1-004; intron 3
OTTHUMT00000388005 ; DICER1-002; intron 3
OTTHUMT00000388006 ; DICER1-003; intron 4
OTTHUMT00000388006 ; DICER1-003; intron 4
OTTHUMT00000388006 ; DICER1-003; intron 4
ENST00000343455 ; DICER1-001; intron 1
ENST00000529206 ; DICER1-005; intron 1
ENST00000527865 ; DICER1-007; intron 1
ENST00000343455 ; DICER1-001; intron 1
ENST00000529206 ; DICER1-005; intron 1
ENST00000527865 ; DICER1-007; intron 1
ENST00000343455 ; DICER1-001; intron 1
ENST00000529206 ; DICER1-005; intron 1
ENST00000527865 ; DICER1-007; intron 1
ENST00000393063 ; DICER1-201; intron 2
ENST00000393063 ; DICER1-201; intron 2
ENST00000393063 ; DICER1-201; intron 2
ENST00000526495 ; DICER1-004; intron 3
ENST00000531162 ; DICER1-002; intron 3
ENST00000526495 ; DICER1-004; intron 3
ENST00000531162 ; DICER1-002; intron 3
ENST00000526495 ; DICER1-004; intron 3
ENST00000531162 ; DICER1-002; intron 3
ENST00000529720 ; DICER1-003; intron 4
ENST00000529720 ; DICER1-003; intron 4
ENST00000529720 ; DICER1-003; intron 4
Database links

Mature sequence hsa-miR-3173-5p

Accession MIMAT0019214
Sequence

5 -  

ugcccugccuguuuucuccuuu

 - 26

Get sequence
Deep sequencing 5 reads, 2 experiments
Evidence experimental; Solexa [2-3]
Predicted targets

Mature sequence hsa-miR-3173-3p

Accession MIMAT0015048
Previous IDs hsa-miR-3173
Sequence

43 -  

aaaggaggaaauaggcaggcca

 - 64

Get sequence
Deep sequencing 14 reads, 5 experiments
Evidence experimental; Solexa [1-3]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
3
PMID:22454130 "Transcription factors are targeted by differentially expressed miRNAs in primates" Dannemann M, Prufer K, Lizano E, Nickel B, Burbano HA, Kelso J Genome Biol Evol. 4:552-564(2012).