Stem-loop sequence hsa-mir-3170

Accession MI0014201
Description Homo sapiens miR-3170 stem-loop
Gene family MIPF0001637; mir-3170
Stem-loop 
         cu               a       agc 
cugguaaca  gggguucugagacag caguguu   u
|||||||||  ||||||||||||||| |||||||   c
gaccauugu  ccccaagauucuguc guuacga   c
         au               c       aga
Get sequence
Deep sequencing
22 reads, 6 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr13: 98860778-98860854 [+]
sense
OTTHUMT00000045541 ; FARP1-001; intron 1
OTTHUMT00000045546 ; FARP1-006; intron 1
OTTHUMT00000045541 ; FARP1-001; intron 1
OTTHUMT00000045546 ; FARP1-006; intron 1
OTTHUMT00000045541 ; FARP1-001; intron 1
OTTHUMT00000045546 ; FARP1-006; intron 1
ENST00000376581 ; FARP1-006; intron 1
ENST00000319562 ; FARP1-001; intron 1
ENST00000376586 ; FARP1-202; intron 1
ENST00000376584 ; FARP1-201; intron 1
ENST00000376581 ; FARP1-006; intron 1
ENST00000319562 ; FARP1-001; intron 1
ENST00000376586 ; FARP1-202; intron 1
ENST00000376584 ; FARP1-201; intron 1
ENST00000376581 ; FARP1-006; intron 1
ENST00000319562 ; FARP1-001; intron 1
ENST00000376586 ; FARP1-201; intron 1
Database links

Mature sequence hsa-miR-3170

Accession MIMAT0015045
Sequence

10 -  

cugggguucugagacagacagu

 - 31

Get sequence
Deep sequencing 22 reads, 6 experiments
Evidence experimental; Solexa [1-2]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).