|
miRBase |
|
Stem-loop sequence hsa-mir-3167 |
|||||
| Accession | MI0014198 | ||||
| Description | Homo sapiens miR-3167 stem-loop | ||||
| Stem-loop |
- a uuu a
ggcugu gg ggcaccaguauuucugaaauucu uucugaa u
|||||| || ||||||||||||||||||||||| |||||||
ccgaca cc cuguggucauaaagacuuuagga aggacuu u
g - --- c
|
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-3167 |
|
| Accession | MIMAT0015042 |
| Sequence |
54 - aggauuucagaaauacuggugu - 75 |
| Deep sequencing | 8 reads, 1 experiments |
| Evidence | experimental; Solexa [1-2] |
| Predicted targets |
|
References |
|
| 1 |
PMID:20300190
"Characterization of the Melanoma miRNAome by Deep Sequencing"
PLoS One. 5:e9685(2010).
|
| 2 |
PMID:20224791
"Discovery of novel microRNAs in female reproductive tract using next generation sequencing"
PLoS One. 5:e9637(2010).
|