|
miRBase |
|
Stem-loop sequence hsa-mir-3166 |
|||||
| Accession | MI0014196 | ||||
| Description | Homo sapiens miR-3166 stem-loop | ||||
| Stem-loop |
g uuucug aaauuuuuuu aggccaguaggcauugucugcguuagga u |||||||||| |||||||||||||||||||||||||||| uuuaaaaaga uccggucauccguaacagacgcaauccu a a ccuacu |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-3166 |
|
| Accession | MIMAT0015040 |
| Sequence |
60 - cgcagacaaugccuacuggccua - 82 |
| Deep sequencing | 5 reads, 2 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:20300190
"Characterization of the Melanoma miRNAome by Deep Sequencing"
PLoS One. 5:e9685(2010).
|