Stem-loop sequence hsa-mir-3166

AccessionMI0014196 (change log)
Symbol HGNC:MIR3166
DescriptionHomo sapiens miR-3166 stem-loop
Stem-loop
             g                            uuucug 
5' aaauuuuuuu aggccaguaggcauugucugcguuagga      u
   |||||||||| ||||||||||||||||||||||||||||       
3' uuuaaaaaga uccggucauccguaacagacgcaauccu      a
             a                            ccuacu 
Get sequence
Deep sequencing
60 reads, 0 reads per million, 12 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 88176502-88176593 [+]
intergenic
Database links

Mature sequence hsa-miR-3166

Accession MIMAT0015040
Sequence

60 - 

cgcagacaaugccuacuggccua

 - 82

Get sequence
Deep sequencing25 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).