Stem-loop sequence hsa-mir-3165

Accession

MI0014195

Description

Homo sapiens miR-3165 stem-loop

Gene family

MIPF0001635; mir-3165

Stem-loop

       c                       ----  u 
ccggugg aagguggaugcaaugugaccuca    ac c
||||||| |||||||||||||||||||||||    || u
ggucacc uuccaccuauguuacacuggagu    ug u
       a                       cucc  g 

Deep sequencing

reads, experiments

Genome context

• Coordinates (GRCh37.p5): chr11: 71783274-71783348 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000395768 ; NUMA1-006; intron 1

  OTTHUMT00000395695 ; NUMA1-002; intron 1

  OTTHUMT00000395769 ; NUMA1-001; intron 1

  OTTHUMT00000395774 ; NUMA1-005; intron 1

  OTTHUMT00000395776 ; NUMA1-004; intron 1

  OTTHUMT00000395779 ; NUMA1-015; intron 1

  OTTHUMT00000395786 ; NUMA1-017; intron 1

  OTTHUMT00000395787 ; NUMA1-020; intron 1

  OTTHUMT00000395789 ; NUMA1-014; intron 1

  OTTHUMT00000395790 ; NUMA1-016; intron 1

  OTTHUMT00000395791 ; NUMA1-019; intron 1

  OTTHUMT00000395793 ; NUMA1-018; intron 1

  OTTHUMT00000395794 ; NUMA1-003; intron 1

  OTTHUMT00000395768 ; NUMA1-006; intron 1

  OTTHUMT00000395695 ; NUMA1-002; intron 1

  OTTHUMT00000395769 ; NUMA1-001; intron 1

  OTTHUMT00000395774 ; NUMA1-005; intron 1

  OTTHUMT00000395776 ; NUMA1-004; intron 1

  OTTHUMT00000395779 ; NUMA1-015; intron 1

  OTTHUMT00000395786 ; NUMA1-017; intron 1

  OTTHUMT00000395787 ; NUMA1-020; intron 1

  OTTHUMT00000395789 ; NUMA1-014; intron 1

  OTTHUMT00000395790 ; NUMA1-016; intron 1

  OTTHUMT00000395791 ; NUMA1-019; intron 1

  OTTHUMT00000395793 ; NUMA1-018; intron 1

  OTTHUMT00000395794 ; NUMA1-003; intron 1

  OTTHUMT00000395768 ; NUMA1-006; intron 1

  OTTHUMT00000395695 ; NUMA1-002; intron 1

  OTTHUMT00000395769 ; NUMA1-001; intron 1

  OTTHUMT00000395774 ; NUMA1-005; intron 1

  OTTHUMT00000395776 ; NUMA1-004; intron 1

  OTTHUMT00000395779 ; NUMA1-015; intron 1

  OTTHUMT00000395786 ; NUMA1-017; intron 1

  OTTHUMT00000395787 ; NUMA1-020; intron 1

  OTTHUMT00000395789 ; NUMA1-014; intron 1

  OTTHUMT00000395790 ; NUMA1-016; intron 1

  OTTHUMT00000395791 ; NUMA1-019; intron 1

  OTTHUMT00000395793 ; NUMA1-018; intron 1

  OTTHUMT00000395794 ; NUMA1-003; intron 1

  OTTHUMT00000395788 ; NUMA1-021; intron 2

  OTTHUMT00000395788 ; NUMA1-021; intron 2

  OTTHUMT00000395788 ; NUMA1-021; intron 2

  ENST00000351960 ; NUMA1-006; intron 1

  ENST00000358965 ; NUMA1-002; intron 1

  ENST00000393695 ; NUMA1-001; intron 1

  ENST00000537217 ; NUMA1-005; intron 1

  ENST00000540843 ; NUMA1-004; intron 1

  ENST00000543937 ; NUMA1-015; intron 1

  ENST00000368959 ; NUMA1-017; intron 1

  ENST00000541719 ; NUMA1-020; intron 1

  ENST00000541641 ; NUMA1-014; intron 1

  ENST00000537905 ; NUMA1-016; intron 1

  ENST00000535111 ; NUMA1-019; intron 1

  ENST00000546131 ; NUMA1-018; intron 1

  ENST00000543450 ; NUMA1-003; intron 1

  ENST00000359652 ; NUMA1-201; intron 1

  ENST00000536544 ; NUMA1-202; intron 1

  ENST00000351960 ; NUMA1-006; intron 1

  ENST00000358965 ; NUMA1-002; intron 1

  ENST00000393695 ; NUMA1-001; intron 1

  ENST00000537217 ; NUMA1-005; intron 1

  ENST00000540843 ; NUMA1-004; intron 1

  ENST00000543937 ; NUMA1-015; intron 1

  ENST00000368959 ; NUMA1-017; intron 1

  ENST00000541719 ; NUMA1-020; intron 1

  ENST00000541641 ; NUMA1-014; intron 1

  ENST00000537905 ; NUMA1-016; intron 1

  ENST00000535111 ; NUMA1-019; intron 1

  ENST00000546131 ; NUMA1-018; intron 1

  ENST00000543450 ; NUMA1-003; intron 1

  ENST00000359652 ; NUMA1-201; intron 1

  ENST00000536544 ; NUMA1-202; intron 1

  ENST00000351960 ; NUMA1-006; intron 1

  ENST00000358965 ; NUMA1-002; intron 1

  ENST00000393695 ; NUMA1-001; intron 1

  ENST00000537217 ; NUMA1-005; intron 1

  ENST00000540843 ; NUMA1-004; intron 1

  ENST00000543937 ; NUMA1-015; intron 1

  ENST00000368959 ; NUMA1-017; intron 1

  ENST00000541719 ; NUMA1-020; intron 1

  ENST00000541641 ; NUMA1-014; intron 1

  ENST00000537905 ; NUMA1-016; intron 1

  ENST00000535111 ; NUMA1-019; intron 1

  ENST00000546131 ; NUMA1-018; intron 1

  ENST00000543450 ; NUMA1-003; intron 1

  ENST00000366394 ; NUMA1-021; intron 2

  ENST00000366394 ; NUMA1-021; intron 2

  ENST00000366394 ; NUMA1-021; intron 2

Database links

• ENTREZGENE: 100422953;MIR3165

Mature sequence hsa-miR-3165

• Accession: MIMAT0015039
• Sequence: 10 - agguggaugcaaugugaccuca - 31
• Evidence: experimental; Solexa [1-2]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-3165
  • MICRORNA.ORG:hsa-miR-3165
  • MIRDB:hsa-miR-3165
  • RNA22-HSA:hsa-miR-3165
  • TARGETMINER:hsa-miR-3165

References

1. PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).