Stem-loop sequence hsa-mir-3164

AccessionMI0014194 (change log)
Symbol HGNC:MIR3164
DescriptionHomo sapiens miR-3164 stem-loop
Stem-loop
   -  u                  g         -caca      
5'  cu ggaaacugugacuuuaag gaaauggcg     gcaga 
    || |||||||||||||||||| |||||||||     |||| c
3'  ga ccuuugacgcugaaguuc uuuugccgu     cgucc 
   g  c                  g         acuaa      
Get sequence
Deep sequencing
502 reads, 0 reads per million, 37 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 69083176-69083258 [+]
sense
OTTHUMT00000396553 ; MYEOV-008; intron 1
OTTHUMT00000396651 ; MYEOV-009; intron 1
ENST00000544008 ; MYEOV-008; intron 1
ENST00000544781 ; MYEOV-009; intron 1
Database links

Mature sequence hsa-miR-3164

Accession MIMAT0015038
Sequence

10 - 

ugugacuuuaagggaaauggcg

 - 31

Get sequence
Deep sequencing495 reads, 37 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).