Stem-loop sequence hsa-mir-3164

Accession MI0014194
Description Homo sapiens miR-3164 stem-loop
Stem-loop 
-  u                  g         -caca      
 cu ggaaacugugacuuuaag gaaauggcg     gcaga 
 || |||||||||||||||||| |||||||||     |||| c
 ga ccuuugacgcugaaguuc uuuugccgu     cgucc 
g  c                  g         acuaa
Get sequence
Deep sequencing
184 reads, 13 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr11: 68850644-68850726 [+]
sense
OTTHUMT00000396883 ; TPCN2-005; intron 12
OTTHUMT00000396883 ; TPCN2-005; intron 12
OTTHUMT00000396883 ; TPCN2-005; intron 12
OTTHUMT00000396877 ; TPCN2-002; intron 14
OTTHUMT00000396877 ; TPCN2-002; intron 14
OTTHUMT00000396877 ; TPCN2-002; intron 14
OTTHUMT00000396881 ; TPCN2-003; intron 16
OTTHUMT00000396881 ; TPCN2-003; intron 16
OTTHUMT00000396881 ; TPCN2-003; intron 16
OTTHUMT00000396878 ; TPCN2-001; intron 18
OTTHUMT00000396878 ; TPCN2-001; intron 18
OTTHUMT00000396878 ; TPCN2-001; intron 18
ENST00000442692 ; TPCN2-005; intron 12
ENST00000442692 ; TPCN2-005; intron 12
ENST00000442692 ; TPCN2-005; intron 12
ENST00000539166 ; TPCN2-002; intron 14
ENST00000539166 ; TPCN2-002; intron 14
ENST00000539166 ; TPCN2-002; intron 14
ENST00000356782 ; TPCN2-201; intron 15
ENST00000356782 ; TPCN2-201; intron 15
ENST00000542467 ; TPCN2-003; intron 16
ENST00000542467 ; TPCN2-003; intron 16
ENST00000542467 ; TPCN2-003; intron 16
ENST00000294309 ; TPCN2-001; intron 18
ENST00000294309 ; TPCN2-001; intron 18
ENST00000294309 ; TPCN2-001; intron 18
Database links

Mature sequence hsa-miR-3164

Accession MIMAT0015038
Sequence

10 -  

ugugacuuuaagggaaauggcg

 - 31

Get sequence
Deep sequencing 184 reads, 13 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).