Stem-loop sequence hsa-mir-3163

Accession MI0014193
Description Homo sapiens miR-3163 stem-loop
Stem-loop 
u                 a   c        cuuc 
 uccucaucuauaaaaug ggg aguaagac    c
 ||||||||||||||||| ||| ||||||||    u
 aggaguagauauuuuac ccc ucauucug    u
a                 c   a        uucc
Get sequence
Deep sequencing
16 reads, 6 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr11: 66701905-66701977 [-]
sense
OTTHUMT00000393115 ; PC-001; intron 2
OTTHUMT00000393120 ; PC-003; intron 2
OTTHUMT00000393121 ; PC-008; intron 2
OTTHUMT00000393115 ; PC-001; intron 2
OTTHUMT00000393120 ; PC-003; intron 2
OTTHUMT00000393121 ; PC-008; intron 2
OTTHUMT00000393115 ; PC-001; intron 2
OTTHUMT00000393120 ; PC-003; intron 2
OTTHUMT00000393121 ; PC-008; intron 2
OTTHUMT00000393122 ; PC-007; intron 3
OTTHUMT00000393122 ; PC-007; intron 3
OTTHUMT00000393122 ; PC-007; intron 3
ENST00000393958 ; PC-001; intron 2
ENST00000524491 ; PC-003; intron 2
ENST00000531614 ; PC-008; intron 2
ENST00000355677 ; PC-201; intron 2
ENST00000393958 ; PC-001; intron 2
ENST00000524491 ; PC-003; intron 2
ENST00000531614 ; PC-008; intron 2
ENST00000355677 ; PC-201; intron 2
ENST00000393958 ; PC-001; intron 2
ENST00000524491 ; PC-003; intron 2
ENST00000531614 ; PC-008; intron 2
ENST00000355677 ; PC-201; intron 2
ENST00000528403 ; PC-007; intron 3
ENST00000393960 ; PC-202; intron 3
ENST00000528403 ; PC-007; intron 3
ENST00000393960 ; PC-202; intron 3
ENST00000528403 ; PC-007; intron 3
ENST00000393960 ; PC-202; intron 3
Database links

Mature sequence hsa-miR-3163

Accession MIMAT0015037
Sequence

10 -  

uauaaaaugagggcaguaagac

 - 31

Get sequence
Deep sequencing 15 reads, 5 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).