Stem-loop sequence hsa-mir-3162

Accession

MI0014192

Description

Homo sapiens miR-3162 stem-loop

Stem-loop

           a      a  a          cau   ca 
cugacuuuuuu gggagu ga ggguggggag   gaa  a
||||||||||| |||||| || ||||||||||   |||   
gacugaaaaaa cccuca cu cccaucccuc   cuu  u
           c      c  c          acu   ug 

Deep sequencing

25 reads, 9 experiments

Genome context

• Coordinates (GRCh37.p5): chr11: 59362550-59362631 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000394558 ; OSBP-004; intron 1

  OTTHUMT00000394558 ; OSBP-004; intron 1

  OTTHUMT00000394558 ; OSBP-004; intron 1

  OTTHUMT00000394557 ; OSBP-002; intron 2

  OTTHUMT00000394557 ; OSBP-002; intron 2

  OTTHUMT00000394557 ; OSBP-002; intron 2

  OTTHUMT00000394555 ; OSBP-001; intron 7

  OTTHUMT00000394555 ; OSBP-001; intron 7

  OTTHUMT00000394555 ; OSBP-001; intron 7

  ENST00000528903 ; OSBP-004; intron 1

  ENST00000378235 ; OSBP-201; intron 1

  ENST00000528903 ; OSBP-004; intron 1

  ENST00000378235 ; OSBP-201; intron 1

  ENST00000528903 ; OSBP-004; intron 1

  ENST00000525357 ; OSBP-002; intron 2

  ENST00000525357 ; OSBP-002; intron 2

  ENST00000525357 ; OSBP-002; intron 2

  ENST00000263847 ; OSBP-001; intron 7

  ENST00000263847 ; OSBP-001; intron 7

  ENST00000263847 ; OSBP-001; intron 7

Database links

• ENTREZGENE: 100422880;MIR3162

Mature sequence hsa-miR-3162-5p

• Accession: MIMAT0015036
• Previous IDs: hsa-miR-3162
• Sequence: 10 - uuagggaguagaaggguggggag - 32
• Deep sequencing: 24 reads, 8 experiments
• Evidence: experimental; Solexa [1-2]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-3162-5p
  • MICRORNA.ORG:hsa-miR-3162-5p
  • MIRDB:hsa-miR-3162-5p
  • RNA22-HSA:hsa-miR-3162-5p
  • TARGETMINER:hsa-miR-3162-5p

Mature sequence hsa-miR-3162-3p

• Accession: MIMAT0019213
• Sequence: 52 - ucccuaccccuccacucccca - 72
• Evidence: experimental; Solexa [2]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-3162-3p
  • MIRDB:hsa-miR-3162-3p
  • TARGETMINER:hsa-miR-3162-3p

References

1. PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).