Stem-loop sequence hsa-mir-3161

Accession

MI0014191

Description

Homo sapiens miR-3161 stem-loop

Stem-loop

  uc a     -ga                 -    aag 
cc  g gagcu   uaagaacagaggcccag auug   u
||  | |||||   ||||||||||||||||| ||||    
gg  c cuuga   auuuuuguuuccggguc ugau   u
  uc -     acc                 g    aag 

Deep sequencing

21 reads, 3 experiments

Genome context

• Coordinates (GRCh37.p5): chr11: 48118334-48118410 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000390525 ; PTPRJ-001; intron 1

  OTTHUMT00000390526 ; PTPRJ-002; intron 1

  OTTHUMT00000391127 ; PTPRJ-006; intron 1

  OTTHUMT00000390527 ; PTPRJ-003; intron 1

  OTTHUMT00000390525 ; PTPRJ-001; intron 1

  OTTHUMT00000390526 ; PTPRJ-002; intron 1

  OTTHUMT00000391127 ; PTPRJ-006; intron 1

  OTTHUMT00000390527 ; PTPRJ-003; intron 1

  OTTHUMT00000390525 ; PTPRJ-001; intron 1

  OTTHUMT00000390526 ; PTPRJ-002; intron 1

  OTTHUMT00000391127 ; PTPRJ-006; intron 1

  OTTHUMT00000390527 ; PTPRJ-003; intron 1

  OTTHUMT00000390528 ; PTPRJ-004; intron 2

  OTTHUMT00000390528 ; PTPRJ-004; intron 2

  OTTHUMT00000390528 ; PTPRJ-004; intron 2

  ENST00000418331 ; PTPRJ-001; intron 1

  ENST00000440289 ; PTPRJ-002; intron 1

  ENST00000534219 ; PTPRJ-006; intron 1

  ENST00000527952 ; PTPRJ-003; intron 1

  ENST00000278456 ; PTPRJ-201; intron 1

  ENST00000418331 ; PTPRJ-001; intron 1

  ENST00000440289 ; PTPRJ-002; intron 1

  ENST00000534219 ; PTPRJ-006; intron 1

  ENST00000527952 ; PTPRJ-003; intron 1

  ENST00000278456 ; PTPRJ-201; intron 1

  ENST00000418331 ; PTPRJ-001; intron 1

  ENST00000440289 ; PTPRJ-002; intron 1

  ENST00000534219 ; PTPRJ-006; intron 1

  ENST00000527952 ; PTPRJ-003; intron 1

  ENST00000526550 ; PTPRJ-004; intron 2

  ENST00000526550 ; PTPRJ-004; intron 2

  ENST00000526550 ; PTPRJ-004; intron 2

Database links

• ENTREZGENE: 100423000;MIR3161

Mature sequence hsa-miR-3161

• Accession: MIMAT0015035
• Sequence: 10 - cugauaagaacagaggcccagau - 32
• Deep sequencing: 20 reads, 2 experiments
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-3161
  • MICRORNA.ORG:hsa-miR-3161
  • MIRDB:hsa-miR-3161
  • RNA22-HSA:hsa-miR-3161
  • TARGETMINER:hsa-miR-3161

References

1. PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).