Stem-loop sequence hsa-mir-3160-1

Accession MI0014189
Description Homo sapiens miR-3160-1 stem-loop
Gene family MIPF0001028; mir-3160
Stem-loop 
                                   --       
ggaccugcccugggcuuucuagucucagcucuccu  ccagcu 
|||||||||||||||||||||||||||||||||||  ||||| c
cuuggacgggacccgaaagaucagagucgagagga  ggucga 
                                   cu
Get sequence
Deep sequencing
17 reads, 9 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr11: 46473355-46473439 [-]
sense
OTTHUMT00000390287 ; AMBRA1-012; intron 1
OTTHUMT00000390287 ; AMBRA1-012; intron 1
OTTHUMT00000390287 ; AMBRA1-012; intron 1
OTTHUMT00000390102 ; AMBRA1-001; intron 10
OTTHUMT00000390154 ; AMBRA1-007; intron 10
OTTHUMT00000390102 ; AMBRA1-001; intron 10
OTTHUMT00000390154 ; AMBRA1-007; intron 10
OTTHUMT00000390102 ; AMBRA1-001; intron 10
OTTHUMT00000390154 ; AMBRA1-007; intron 10
OTTHUMT00000390100 ; AMBRA1-002; intron 11
OTTHUMT00000390103 ; AMBRA1-005; intron 11
OTTHUMT00000390100 ; AMBRA1-002; intron 11
OTTHUMT00000390103 ; AMBRA1-005; intron 11
OTTHUMT00000390100 ; AMBRA1-002; intron 11
OTTHUMT00000390103 ; AMBRA1-005; intron 11
OTTHUMT00000390099 ; AMBRA1-006; intron 12
OTTHUMT00000390099 ; AMBRA1-006; intron 12
OTTHUMT00000390099 ; AMBRA1-006; intron 12
ENST00000529553 ; AMBRA1-012; intron 1
ENST00000529553 ; AMBRA1-012; intron 1
ENST00000529553 ; AMBRA1-012; intron 1
ENST00000534300 ; AMBRA1-001; intron 10
ENST00000528950 ; AMBRA1-007; intron 10
ENST00000426438 ; AMBRA1-203; intron 10
ENST00000298834 ; AMBRA1-201; intron 10
ENST00000534300 ; AMBRA1-001; intron 10
ENST00000528950 ; AMBRA1-007; intron 10
ENST00000426438 ; AMBRA1-203; intron 10
ENST00000298834 ; AMBRA1-201; intron 10
ENST00000534300 ; AMBRA1-001; intron 10
ENST00000528950 ; AMBRA1-007; intron 10
ENST00000426438 ; AMBRA1-202; intron 10
ENST00000298834 ; AMBRA1-201; intron 10
ENST00000533727 ; AMBRA1-002; intron 11
ENST00000458649 ; AMBRA1-005; intron 11
ENST00000533727 ; AMBRA1-002; intron 11
ENST00000458649 ; AMBRA1-005; intron 11
ENST00000533727 ; AMBRA1-002; intron 11
ENST00000458649 ; AMBRA1-005; intron 11
ENST00000314845 ; AMBRA1-006; intron 12
ENST00000314845 ; AMBRA1-006; intron 12
ENST00000314845 ; AMBRA1-006; intron 12
ENST00000314823 ; AMBRA1-202; intron 13
ENST00000314823 ; AMBRA1-202; intron 13
Clustered miRNAs
< 10kb from hsa-mir-3160-1
hsa-mir-3160-2 chr11: 46473357-46473437 [+]
hsa-mir-3160-1 chr11: 46473355-46473439 [-]
Database links

Mature sequence hsa-miR-3160-5p

Accession MIMAT0019212
Sequence

13 -  

ggcuuucuagucucagcucucc

 - 34

Get sequence
Evidence experimental; Solexa [2]
Predicted targets

Mature sequence hsa-miR-3160-3p

Accession MIMAT0015034
Previous IDs hsa-miR-3160
Sequence

54 -  

agagcugagacuagaaagccca

 - 75

Get sequence
Deep sequencing 35 reads, 9 experiments
Evidence experimental; Solexa [1-2]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).