|
miRBase |
|
Stem-loop sequence hsa-mir-3159 |
|||||
| Accession | MI0014188 | ||||
| Description | Homo sapiens miR-3159 stem-loop | ||||
| Stem-loop |
c a a c -gg ccaaagu cu ggauuaca gugu ggccac gcu ||||||| || |||||||| |||| |||||| || g gguuuua ga ccuaaugu cgca ucggug cgg c c c c aca |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-3159 |
|
| Accession | MIMAT0015033 |
| Sequence |
10 - uaggauuacaagugucggccac - 31 |
| Deep sequencing | 11 reads, 4 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:20300190
"Characterization of the Melanoma miRNAome by Deep Sequencing"
PLoS One. 5:e9685(2010).
|