Stem-loop sequence hsa-mir-3158-2

AccessionMI0014187 (change log)
Symbol HGNC:MIR3158-2
DescriptionHomo sapiens miR-3158-2 stem-loop
Gene family MIPF0001065; mir-3158
Stem-loop
                                    caauac 
5' auucaggccgguccugcagagaggaagcccuuc      c
   |||||||||||||||||||||||||||||||||      u
3' uaaguccggccaggacgucucuccuucgggaag      g
                                    acgaau 
Get sequence
Deep sequencing
4183 reads, 2.96 reads per million, 135 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 101601417-101601497 [-]
antisense
OTTHUMT00000049825 ; ABCC2-001; intron 25
ENST00000370449 ; ABCC2-001; intron 25
Clustered miRNAs
< 10kb from hsa-mir-3158-2
hsa-mir-3158-1chr10: 101601417-101601497 [+]
hsa-mir-3158-2chr10: 101601417-101601497 [-]
Database links

Mature sequence hsa-miR-3158-5p

Accession MIMAT0019211
Sequence

13 - 

ccugcagagaggaagcccuuc

 - 33

Get sequence
Deep sequencing813 reads, 64 experiments
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-3158-3p

Accession MIMAT0015032
Previous IDshsa-miR-3158
Sequence

50 - 

aagggcuuccucucugcaggac

 - 71

Get sequence
Deep sequencing7575 reads, 133 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).