Stem-loop sequence hsa-mir-3158-1

Accession MI0014186
Description Homo sapiens miR-3158-1 stem-loop
Gene family MIPF0001065; mir-3158
Stem-loop 
                                  ---   u 
auucaggccgguccugcagagaggaagcccuucu   gcu a
||||||||||||||||||||||||||||||||||   |||  
uaaguccggccaggacgucucuccuucgggaagg   ugg c
                                  uua   a
Get sequence
Deep sequencing
96 reads, 17 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr10: 103361174-103361254 [+]
sense
OTTHUMT00000049962 ; RP11-529I10.4-005; intron 2
OTTHUMT00000049962 ; RP11-529I10.4-005; intron 2
OTTHUMT00000049962 ; RP11-529I10.4-005; intron 2
OTTHUMT00000049961 ; RP11-529I10.4-004; intron 3
OTTHUMT00000049961 ; RP11-529I10.4-004; intron 3
OTTHUMT00000049961 ; RP11-529I10.4-004; intron 3
OTTHUMT00000049958 ; RP11-529I10.4-001; intron 4
OTTHUMT00000049959 ; RP11-529I10.4-002; intron 4
OTTHUMT00000049958 ; RP11-529I10.4-001; intron 4
OTTHUMT00000049959 ; RP11-529I10.4-002; intron 4
OTTHUMT00000049958 ; RP11-529I10.4-001; intron 4
OTTHUMT00000049959 ; RP11-529I10.4-002; intron 4
ENST00000475443 ; DPCD-005; intron 2
ENST00000475443 ; DPCD-005; intron 2
ENST00000475443 ; DPCD-005; intron 2
ENST00000434727 ; DPCD-004; intron 3
ENST00000434727 ; DPCD-004; intron 3
ENST00000434727 ; DPCD-004; intron 3
ENST00000370151 ; DPCD-001; intron 4
ENST00000370147 ; DPCD-002; intron 4
ENST00000370148 ; DPCD-201; intron 4
ENST00000370149 ; DPCD-202; intron 4
ENST00000370151 ; DPCD-001; intron 4
ENST00000370147 ; DPCD-002; intron 4
ENST00000370148 ; DPCD-201; intron 4
ENST00000370149 ; DPCD-202; intron 4
ENST00000370151 ; DPCD-001; intron 4
ENST00000370147 ; DPCD-002; intron 4
ENST00000370148 ; DPCD-201; intron 4
Clustered miRNAs
< 10kb from hsa-mir-3158-1
hsa-mir-3158-1 chr10: 103361174-103361254 [+]
hsa-mir-3158-2 chr10: 103361174-103361254 [-]
Database links

Mature sequence hsa-miR-3158-5p

Accession MIMAT0019211
Sequence

13 -  

ccugcagagaggaagcccuuc

 - 33

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence experimental; Solexa [3]
Predicted targets

Mature sequence hsa-miR-3158-3p

Accession MIMAT0015032
Previous IDs hsa-miR-3158
Sequence

50 -  

aagggcuuccucucugcaggac

 - 71

Get sequence
Deep sequencing 173 reads, 18 experiments
Evidence experimental; Solexa [1-3]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
3
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).