Stem-loop sequence hsa-mir-3157

Accession MI0014185
Description Homo sapiens miR-3157 stem-loop
Stem-loop 
               c       u      ugcu ug g   a 
gggaagggcuucagc aggcuag gcaguc    u  u cca c
||||||||||||||| ||||||| ||||||    |  | |||  
cccuuuucgaagucg ucugauc cgucag    a  g ggu a
               a       c      ---u gu g   c
Get sequence
Deep sequencing
21 reads, 9 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr10: 97824072-97824156 [-]
sense
OTTHUMT00000049575 ; RP11-429G19.2-001; intron 2
OTTHUMT00000049576 ; RP11-429G19.2-002; intron 2
OTTHUMT00000049577 ; RP11-429G19.2-003; intron 2
OTTHUMT00000049578 ; RP11-429G19.2-004; intron 2
OTTHUMT00000049583 ; RP11-429G19.2-009; intron 2
OTTHUMT00000049585 ; RP11-429G19.2-011; intron 2
OTTHUMT00000049575 ; RP11-429G19.2-001; intron 2
OTTHUMT00000049576 ; RP11-429G19.2-002; intron 2
OTTHUMT00000049577 ; RP11-429G19.2-003; intron 2
OTTHUMT00000049578 ; RP11-429G19.2-004; intron 2
OTTHUMT00000049583 ; RP11-429G19.2-009; intron 2
OTTHUMT00000049585 ; RP11-429G19.2-011; intron 2
OTTHUMT00000049575 ; RP11-429G19.2-001; intron 2
OTTHUMT00000049576 ; RP11-429G19.2-002; intron 2
OTTHUMT00000049577 ; RP11-429G19.2-003; intron 2
OTTHUMT00000049578 ; RP11-429G19.2-004; intron 2
OTTHUMT00000049583 ; RP11-429G19.2-009; intron 2
OTTHUMT00000049585 ; RP11-429G19.2-011; intron 2
ENST00000458228 ; RP11-429G19.2-001; intron 2
ENST00000454638 ; RP11-429G19.2-002; intron 2
ENST00000452728 ; RP11-429G19.2-003; intron 2
ENST00000416301 ; RP11-429G19.2-004; intron 2
ENST00000451364 ; RP11-429G19.2-009; intron 2
ENST00000427846 ; RP11-429G19.2-011; intron 2
ENST00000458228 ; RP11-429G19.2-001; intron 2
ENST00000454638 ; RP11-429G19.2-002; intron 2
ENST00000452728 ; RP11-429G19.2-003; intron 2
ENST00000416301 ; RP11-429G19.2-004; intron 2
ENST00000451364 ; RP11-429G19.2-009; intron 2
ENST00000427846 ; RP11-429G19.2-011; intron 2
ENST00000458228 ; RP11-429G19.2-001; intron 2
ENST00000454638 ; RP11-429G19.2-002; intron 2
ENST00000452728 ; RP11-429G19.2-003; intron 2
ENST00000416301 ; RP11-429G19.2-004; intron 2
ENST00000451364 ; RP11-429G19.2-009; intron 2
ENST00000427846 ; RP11-429G19.2-011; intron 2
Database links

Mature sequence hsa-miR-3157-5p

Accession MIMAT0015031
Previous IDs hsa-miR-3157
Sequence

10 -  

uucagccaggcuagugcagucu

 - 31

Get sequence
Deep sequencing 21 reads, 9 experiments
Evidence experimental; Solexa [1-2]
Predicted targets

Mature sequence hsa-miR-3157-3p

Accession MIMAT0019210
Sequence

58 -  

cugcccuagucuagcugaagcu

 - 79

Get sequence
Evidence experimental; Solexa [2]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).