Stem-loop sequence hsa-mir-3155a

Accession MI0014183
Previous IDs hsa-mir-3155
Description Homo sapiens miR-3155a stem-loop
Gene family MIPF0001242; mir-3155
Stem-loop 
           cc                      cc   c 
uccgggcauca  ucccacugcagagccuggggag  gga a
|||||||||||  ||||||||||||||||||||||  |||  
agguccguagu  agggugacgucucggacccuuc  ccu g
           ca                      --   c
Get sequence
Deep sequencing
7 reads, 3 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr10: 6194159-6194240 [+]
sense
OTTHUMT00000046646 ; PFKFB3-001; intron 1
OTTHUMT00000046646 ; PFKFB3-001; intron 1
OTTHUMT00000046646 ; PFKFB3-001; intron 1
ENST00000536985 ; PFKFB3-205; intron 1
ENST00000540253 ; PFKFB3-206; intron 1
ENST00000379784 ; PFKFB3-203; intron 1
ENST00000379781 ; PFKFB3-201; intron 1
ENST00000379789 ; PFKFB3-001; intron 1
ENST00000379789 ; PFKFB3-001; intron 1
ENST00000536985 ; PFKFB3-205; intron 1
ENST00000540253 ; PFKFB3-206; intron 1
ENST00000379784 ; PFKFB3-203; intron 1
ENST00000379781 ; PFKFB3-201; intron 1
ENST00000379789 ; PFKFB3-001; intron 1
ENST00000536985 ; PFKFB3-202; intron 1
ENST00000540253 ; PFKFB3-203; intron 1
Clustered miRNAs
< 10kb from hsa-mir-3155a
hsa-mir-3155a chr10: 6194159-6194240 [+]
hsa-mir-3155b chr10: 6194170-6194225 [-]
Database links

Mature sequence hsa-miR-3155a

Accession MIMAT0015029
Previous IDs hsa-miR-3155
Sequence

52 -  

ccaggcucugcagugggaacu

 - 72

Get sequence
Deep sequencing 5 reads, 2 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).