Stem-loop sequence hsa-mir-3154

Accession MI0014182
Description Homo sapiens miR-3154 stem-loop
Gene family MIPF0001387; mir-3154
Stem-loop 
  -      cu   ca  -          g  caccc     -a gu 
gg ccccuc  ucu  gc cccagcuccc cu     cugcc  c  c
|| ||||||  |||  || |||||||||| ||     |||||  |   
cc ggggag  aga  cg ggguugaggg ga     gacgg  g  a
  a      --   --  a          -  ----a     ag aa
Get sequence
Deep sequencing
55 reads, 8 experiments
Comments

Berezikov et al. proposed this sequence as a miRNA candidate based on the RAKE method [1]. Goff et al. [2] and Stark et al. [3] later validated its expression in human using high-throughput sequencing.

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr9: 131007226-131007309 [-]
antisense
OTTHUMT00000054371 ; DNM1-005; intron 2
OTTHUMT00000054372 ; DNM1-006; intron 2
OTTHUMT00000054371 ; DNM1-005; intron 2
OTTHUMT00000054372 ; DNM1-006; intron 2
OTTHUMT00000054371 ; DNM1-005; intron 2
OTTHUMT00000054372 ; DNM1-006; intron 2
OTTHUMT00000259166 ; DNM1-004; intron 14
OTTHUMT00000259166 ; DNM1-004; intron 14
OTTHUMT00000259166 ; DNM1-004; intron 14
OTTHUMT00000355651 ; DNM1-007; intron 15
OTTHUMT00000355653 ; DNM1-009; intron 15
OTTHUMT00000054367 ; DNM1-001; intron 15
OTTHUMT00000054368 ; DNM1-002; intron 15
OTTHUMT00000355654 ; DNM1-010; intron 15
OTTHUMT00000355651 ; DNM1-007; intron 15
OTTHUMT00000355653 ; DNM1-009; intron 15
OTTHUMT00000054367 ; DNM1-001; intron 15
OTTHUMT00000054368 ; DNM1-002; intron 15
OTTHUMT00000355654 ; DNM1-010; intron 15
OTTHUMT00000355651 ; DNM1-007; intron 15
OTTHUMT00000355653 ; DNM1-009; intron 15
OTTHUMT00000054367 ; DNM1-001; intron 15
OTTHUMT00000054368 ; DNM1-002; intron 15
OTTHUMT00000355654 ; DNM1-010; intron 15
ENST00000479174 ; DNM1-005; intron 2
ENST00000493925 ; DNM1-006; intron 2
ENST00000479174 ; DNM1-005; intron 2
ENST00000493925 ; DNM1-006; intron 2
ENST00000479174 ; DNM1-005; intron 2
ENST00000493925 ; DNM1-006; intron 2
ENST00000543158 ; DNM1-202; intron 5
ENST00000543158 ; DNM1-202; intron 5
ENST00000441149 ; DNM1-004; intron 14
ENST00000393589 ; DNM1-201; intron 14
ENST00000441149 ; DNM1-004; intron 14
ENST00000393589 ; DNM1-201; intron 14
ENST00000441149 ; DNM1-004; intron 14
ENST00000475805 ; DNM1-007; intron 15
ENST00000341179 ; DNM1-009; intron 15
ENST00000372923 ; DNM1-001; intron 15
ENST00000393594 ; DNM1-002; intron 15
ENST00000486160 ; DNM1-010; intron 15
ENST00000475805 ; DNM1-007; intron 15
ENST00000341179 ; DNM1-009; intron 15
ENST00000372923 ; DNM1-001; intron 15
ENST00000393594 ; DNM1-002; intron 15
ENST00000486160 ; DNM1-010; intron 15
ENST00000475805 ; DNM1-007; intron 15
ENST00000341179 ; DNM1-009; intron 15
ENST00000372923 ; DNM1-001; intron 15
ENST00000393594 ; DNM1-002; intron 15
ENST00000486160 ; DNM1-010; intron 15
Clustered miRNAs
< 10kb from hsa-mir-3154
hsa-mir-3154 chr9: 131007226-131007309 [-]
hsa-mir-199b chr9: 131007000-131007109 [-]
Database links

Mature sequence hsa-miR-3154

Accession MIMAT0015028
Sequence

54 -  

cagaaggggaguugggagcaga

 - 75

Get sequence
Deep sequencing 55 reads, 8 experiments
Evidence experimental; SOLiD [2], Solexa [3-5]
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:19784364 "Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors" Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE, Hart RP PLoS One. 4:e7192(2009).
3
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
4
PMID:21606961 "Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia" Schotte D, Moqadam FA, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML Leukemia. 25:1389-1399(2011).
5
PMID:22454130 "Transcription factors are targeted by differentially expressed miRNAs in primates" Dannemann M, Prufer K, Lizano E, Nickel B, Burbano HA, Kelso J Genome Biol Evol. 4:552-564(2012).