Stem-loop sequence hsa-mir-3074

Accession MI0014181
Description Homo sapiens miR-3074 stem-loop
Gene family MIPF0000041; mir-24
Stem-loop 
     -a    u  u        a    -gc    gugua 
gcucg  cucc gu ccugcuga cuga   cagu     a
|||||  |||| || |||||||| ||||   ||||     a
ugggc  gagg ca ggaugacu gacu   guca     a
     gg    c  c        c    aua    agagu
Get sequence
Deep sequencing
6 reads, 3 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr9: 97848296-97848376 [-]
antisense
OTTHUMT00000053202 ; C9orf3-007; intron 4
OTTHUMT00000053202 ; C9orf3-007; intron 4
OTTHUMT00000053202 ; C9orf3-007; intron 4
OTTHUMT00000053196 ; C9orf3-001; intron 5
OTTHUMT00000053209 ; C9orf3-014; intron 5
OTTHUMT00000053196 ; C9orf3-001; intron 5
OTTHUMT00000053209 ; C9orf3-014; intron 5
OTTHUMT00000053196 ; C9orf3-001; intron 5
OTTHUMT00000053209 ; C9orf3-014; intron 5
OTTHUMT00000053211 ; C9orf3-016; exon 7
OTTHUMT00000053211 ; C9orf3-016; exon 7
OTTHUMT00000053211 ; C9orf3-016; exon 7
OTTHUMT00000053197 ; C9orf3-002; intron 14
OTTHUMT00000053197 ; C9orf3-002; intron 14
OTTHUMT00000053197 ; C9orf3-002; intron 14
OTTHUMT00000053203 ; C9orf3-008; intron 15
OTTHUMT00000053203 ; C9orf3-008; intron 15
OTTHUMT00000053203 ; C9orf3-008; intron 15
ENST00000468164 ; C9orf3-007; intron 4
ENST00000468164 ; C9orf3-007; intron 4
ENST00000468164 ; C9orf3-007; intron 4
ENST00000471978 ; C9orf3-014; intron 5
ENST00000463372 ; C9orf3-001; intron 5
ENST00000471978 ; C9orf3-014; intron 5
ENST00000463372 ; C9orf3-001; intron 5
ENST00000471978 ; C9orf3-014; intron 5
ENST00000463372 ; C9orf3-001; intron 5
ENST00000375314 ; C9orf3-201; intron 6
ENST00000375314 ; C9orf3-201; intron 6
ENST00000478473 ; C9orf3-016; exon 7
ENST00000478473 ; C9orf3-016; exon 7
ENST00000478473 ; C9orf3-016; exon 7
ENST00000297979 ; C9orf3-002; intron 14
ENST00000297979 ; C9orf3-002; intron 14
ENST00000297979 ; C9orf3-002; intron 14
ENST00000428313 ; C9orf3-008; intron 15
ENST00000375315 ; C9orf3-202; intron 15
ENST00000428313 ; C9orf3-008; intron 15
ENST00000375315 ; C9orf3-202; intron 15
ENST00000428313 ; C9orf3-008; intron 15
ENST00000375315 ; C9orf3-201; intron 15
Clustered miRNAs
< 10kb from hsa-mir-3074
hsa-mir-24-1 chr9: 97848303-97848370 [+]
hsa-mir-3074 chr9: 97848296-97848376 [-]
hsa-mir-27b chr9: 97847727-97847823 [+]
hsa-mir-23b chr9: 97847490-97847586 [+]
Database links

Mature sequence hsa-miR-3074-5p

Accession MIMAT0019208
Sequence

12 -  

guuccugcugaacugagccag

 - 32

Get sequence
Evidence experimental; Solexa [2]
Predicted targets

Mature sequence hsa-miR-3074-3p

Accession MIMAT0015027
Previous IDs hsa-miR-3074
Sequence

50 -  

gauaucagcucaguaggcaccg

 - 71

Get sequence
Deep sequencing 6 reads, 3 experiments
Evidence experimental; Solexa [1-2]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).