|
miRBase |
|
Stem-loop sequence hsa-mir-3152 |
|||||
| Accession | MI0014179 | ||||
| Description | Homo sapiens miR-3152 stem-loop | ||||
| Stem-loop |
-a cu gugcagaguuauugccucuguucuaacaca ga a |||||||||||||||||||||||||||||| || g cacgucucaauaacggggauaagauugugu cu g cc uc |
||||
| Deep sequencing |
| ||||
| Comments |
Berezikov et al. proposed this sequence as a miRNA candidate based on the RAKE method [1]. Stark et al. later validated its expression in human using high-throughput sequencing [2]. |
||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-3152-5p |
|
| Accession | MIMAT0019207 |
| Sequence |
11 - auugccucuguucuaacacaag - 32 |
| Deep sequencing | 2 reads, 1 experiments |
| Evidence | experimental; Solexa [4] |
| Predicted targets |
|
Mature sequence hsa-miR-3152-3p |
|
| Accession | MIMAT0015025 |
| Previous IDs | hsa-miR-3152 |
| Sequence |
45 - uguguuagaauaggggcaauaa - 66 |
| Deep sequencing | 11 reads, 2 experiments |
| Evidence | experimental; Solexa [2-4] |
| Predicted targets |
|
References |
|
| 1 |
PMID:16954537
"Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis"
Genome Res. 16:1289-1298(2006).
|
| 2 |
PMID:20300190
"Characterization of the Melanoma miRNAome by Deep Sequencing"
PLoS One. 5:e9685(2010).
|
| 3 |
PMID:20224791
"Discovery of novel microRNAs in female reproductive tract using next generation sequencing"
PLoS One. 5:e9637(2010).
|
| 4 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|