|
miRBase |
|
Stem-loop sequence hsa-mir-3151 |
|||||
| Accession | MI0014178 | ||||
| Description | Homo sapiens miR-3151 stem-loop | ||||
| Gene family | MIPF0001394; mir-3151 | ||||
| Stem-loop |
g aa ----- c ggggugauggguggg c ugggaucaggu gccu a ||||||||||||||| | ||||||||||| |||| ccccacuguccaccc g acccuagucca cggg a - ac cccua a |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-3151 |
|
| Accession | MIMAT0015024 |
| Sequence |
10 - gguggggcaaugggaucaggu - 30 |
| Deep sequencing | 70 reads, 6 experiments |
| Evidence | experimental; Solexa [1-3] |
| Predicted targets |
|
References |
|
| 1 |
PMID:20300190
"Characterization of the Melanoma miRNAome by Deep Sequencing"
PLoS One. 5:e9685(2010).
|
| 2 |
PMID:21606961
"Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia"
Leukemia. 25:1389-1399(2011).
|
| 3 |
PMID:22454130
"Transcription factors are targeted by differentially expressed miRNAs in primates"
Genome Biol Evol. 4:552-564(2012).
|