Stem-loop sequence hsa-mir-3150a

Accession MI0014177
Previous IDs hsa-mir-3150
Description Homo sapiens miR-3150a stem-loop
Gene family MIPF0001102; mir-3150
Stem-loop 
                    c            a c  a 
gggaagcaggccaaccucga gaucuccucagc c ug a
|||||||||||||||||||| |||||||||||| | || c
ccuuucguccgguuggagcu cuagaggggucg g ac g
                    c            - a  c
Get sequence
Deep sequencing
2 reads, 1 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr8: 96085142-96085221 [+]
sense
OTTHUMT00000379952 ; C8orf38-016; intron 1
OTTHUMT00000379952 ; C8orf38-016; intron 1
OTTHUMT00000379952 ; C8orf38-016; intron 1
OTTHUMT00000379949 ; C8orf38-006; intron 9
OTTHUMT00000379949 ; C8orf38-006; intron 9
OTTHUMT00000379949 ; C8orf38-006; intron 9
ENST00000523184 ; C8orf38-016; intron 1
ENST00000523184 ; C8orf38-016; intron 1
ENST00000523184 ; NDUFAF6-016; intron 1
ENST00000520757 ; C8orf38-006; intron 9
ENST00000286687 ; C8orf38-201; intron 9
ENST00000520757 ; C8orf38-006; intron 9
ENST00000286687 ; C8orf38-201; intron 9
ENST00000520757 ; NDUFAF6-006; intron 9
ENST00000286687 ; NDUFAF6-201; intron 9
antisense
OTTHUMT00000379663 ; RP11-320N21.1-003; intron 1
OTTHUMT00000379662 ; RP11-320N21.1-001; exon 1
OTTHUMT00000379663 ; RP11-320N21.1-003; intron 1
OTTHUMT00000379662 ; RP11-320N21.1-001; exon 1
OTTHUMT00000379663 ; RP11-320N21.1-003; intron 1
OTTHUMT00000379848 ; RP11-320N21.2-001; intron 3
OTTHUMT00000379848 ; RP11-320N21.2-001; intron 3
OTTHUMT00000379848 ; RP11-320N21.2-001; intron 3
ENST00000517864 ; RP11-320N21.1-003; intron 1
ENST00000501164 ; RP11-320N21.1-001; exon 1
ENST00000517864 ; RP11-320N21.1-003; intron 1
ENST00000501164 ; RP11-320N21.1-001; exon 1
ENST00000517864 ; RP11-320N21.1-003; intron 1
ENST00000580142 ; MIR3150B-201; exon 1
ENST00000518598 ; RP11-320N21.2-001; intron 3
ENST00000518598 ; RP11-320N21.2-001; intron 3
ENST00000518598 ; RP11-320N21.2-001; intron 3
Clustered miRNAs
< 10kb from hsa-mir-3150a
hsa-mir-3150b chr8: 96085139-96085224 [-]
hsa-mir-3150a chr8: 96085142-96085221 [+]
Database links

Mature sequence hsa-miR-3150a-5p

Accession MIMAT0019206
Sequence

12 -  

caaccucgacgaucuccucagc

 - 33

Get sequence
Evidence experimental; Solexa [2]
Predicted targets

Mature sequence hsa-miR-3150a-3p

Accession MIMAT0015023
Previous IDs hsa-miR-3150
Sequence

49 -  

cuggggagauccucgagguugg

 - 70

Get sequence
Deep sequencing 2 reads, 1 experiments
Evidence experimental; Solexa [1-2]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).