Stem-loop sequence hsa-mir-1273c

Accession MI0014171
Description Homo sapiens miR-1273c stem-loop
Gene family MIPF0001481; mir-1273c
Stem-loop 
ug    c         a        c       uuuu 
  cagc ugggcgaca aacgagac cugucuu    u
  |||| ||||||||| |||||||| |||||||    u
  gucg acccguugu uugcucug gacagag    u
ag    a         c        a       ucuu
Get sequence
Deep sequencing
37 reads, 17 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr6: 155174494-155174570 [+]
sense
OTTHUMT00000387980 ; TIAM2-005; intron 1
OTTHUMT00000399736 ; TIAM2-013; intron 1
OTTHUMT00000042802 ; TIAM2-002; intron 1
OTTHUMT00000387980 ; TIAM2-005; intron 1
OTTHUMT00000399736 ; TIAM2-013; intron 1
OTTHUMT00000042802 ; TIAM2-002; intron 1
OTTHUMT00000387980 ; TIAM2-005; intron 1
OTTHUMT00000399736 ; TIAM2-013; intron 1
OTTHUMT00000042802 ; TIAM2-002; intron 1
ENST00000461783 ; TIAM2-005; intron 1
ENST00000535064 ; TIAM2-013; intron 1
ENST00000460692 ; TIAM2-002; intron 1
ENST00000528928 ; TIAM2-204; intron 1
ENST00000461783 ; TIAM2-005; intron 1
ENST00000535064 ; TIAM2-013; intron 1
ENST00000460692 ; TIAM2-002; intron 1
ENST00000528928 ; TIAM2-204; intron 1
ENST00000461783 ; TIAM2-005; intron 1
ENST00000535064 ; TIAM2-013; intron 1
ENST00000460692 ; TIAM2-002; intron 1
Database links

Mature sequence hsa-miR-1273c

Accession MIMAT0015017
Sequence

10 -  

ggcgacaaaacgagacccuguc

 - 31

Get sequence
Deep sequencing 13 reads, 5 experiments
Evidence experimental; Solexa [1-2]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).