Stem-loop sequence hsa-mir-548u

Accession MI0014168
Description Homo sapiens miR-548u stem-loop
Gene family MIPF0000317; mir-548
Stem-loop 
      a               - ug      u  u   c 
auuagg uggugcaaaaguaau g  guuuuu uc uua u
|||||| ||||||||||||||| |  |||||| || |||  
uaaucc accgcguuuucauua c  cagaaa gg aau u
      a               a gu      c  u   u
Get sequence
Deep sequencing
66 reads, 12 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr6: 57254930-57255010 [+]
sense
OTTHUMT00000043469 ; PRIM2-002; intron 2
OTTHUMT00000043469 ; PRIM2-002; intron 2
OTTHUMT00000043469 ; PRIM2-002; intron 2
OTTHUMT00000043468 ; PRIM2-001; intron 7
OTTHUMT00000043468 ; PRIM2-001; intron 7
OTTHUMT00000043468 ; PRIM2-001; intron 7
ENST00000490313 ; PRIM2-002; intron 2
ENST00000490313 ; PRIM2-002; intron 2
ENST00000490313 ; PRIM2-002; intron 2
ENST00000389488 ; PRIM2-001; intron 7
ENST00000389488 ; PRIM2-001; intron 7
ENST00000389488 ; PRIM2-001; intron 7
Database links

Mature sequence hsa-miR-548u

Accession MIMAT0015013
Sequence

49 -  

caaagacugcaauuacuuuugcg

 - 71

Get sequence
Deep sequencing 66 reads, 12 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).