Stem-loop sequence hsa-mir-3135a

Accession MI0014156
Previous IDs hsa-mir-3135
Description Homo sapiens miR-3135a stem-loop
Gene family MIPF0001219; mir-3135
Stem-loop 
      u  u       ---c    a         u  aa 
ucacuu gg gccuagg    ugag cugcagugg gc  u
|||||| || |||||||    |||| ||||||||| ||  c
agugga cu cgggucc    guuc gacgucacu ug  u
      -  -       ucca    c         -  ac
Get sequence
Deep sequencing
50 reads, 9 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr3: 20179057-20179133 [+]
sense
OTTHUMT00000340007 ; KAT2B-004; intron 2
OTTHUMT00000340007 ; KAT2B-004; intron 2
OTTHUMT00000340007 ; KAT2B-004; intron 2
OTTHUMT00000252880 ; KAT2B-001; intron 12
OTTHUMT00000252880 ; KAT2B-001; intron 12
OTTHUMT00000252880 ; KAT2B-001; intron 12
ENST00000468111 ; KAT2B-004; intron 2
ENST00000468111 ; KAT2B-004; intron 2
ENST00000468111 ; KAT2B-004; intron 2
ENST00000263754 ; KAT2B-001; intron 12
ENST00000263754 ; KAT2B-001; intron 12
ENST00000263754 ; KAT2B-001; intron 12
Database links

Mature sequence hsa-miR-3135a

Accession MIMAT0015001
Previous IDs hsa-miR-3135
Sequence

10 -  

ugccuaggcugagacugcagug

 - 31

Get sequence
Deep sequencing 48 reads, 8 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).