Stem-loop sequence hsa-mir-3132

Accession MI0014152
Description Homo sapiens miR-3132 stem-loop
Gene family MIPF0001509; mir-3132
Stem-loop 
           u    -a   a      a   ----c  u 
ggugggauggg agag  agg gcucag gga     gg g
||||||||||| ||||  ||| |||||| |||     ||  
ccacccuacuc ucuc  ucc cgaguu ccu     cc c
           -    cc   -      c   uuguu  g
Get sequence
Deep sequencing
6 reads, 3 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr2: 220413795-220413869 [-]
sense
ENST00000535056 ; DNPEP-202; intron 2
ENST00000535056 ; DNPEP-202; intron 2
antisense
OTTHUMT00000131062 ; TMEM198-001; intron 3
OTTHUMT00000131062 ; TMEM198-001; intron 3
OTTHUMT00000131062 ; TMEM198-001; intron 3
OTTHUMT00000131063 ; TMEM198-002; intron 4
OTTHUMT00000131063 ; TMEM198-002; intron 4
OTTHUMT00000131063 ; TMEM198-002; intron 4
ENST00000373883 ; TMEM198-001; intron 3
ENST00000373883 ; TMEM198-001; intron 3
ENST00000373883 ; TMEM198-001; intron 3
ENST00000344458 ; TMEM198-002; intron 4
ENST00000344458 ; TMEM198-002; intron 4
ENST00000344458 ; TMEM198-002; intron 4
Database links

Mature sequence hsa-miR-3132

Accession MIMAT0014997
Sequence

8 -  

uggguagagaaggagcucagagga

 - 31

Get sequence
Deep sequencing 6 reads, 3 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).