Stem-loop sequence hsa-mir-3131

Accession MI0014151
Description Homo sapiens miR-3131 stem-loop
Stem-loop 
   uc    a    u  -a        --  cc 
gag  gagg cugg gg  agggccuu  uc  c
|||  |||| |||| ||  ||||||||  ||   
cuc  cuuc gacc cc  ucccggaa  ag  u
   uu    -    -  gg        cc  ac
Get sequence
Deep sequencing
95 reads, 5 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr2: 219923410-219923472 [-]
sense
OTTHUMT00000336408 ; IHH-001; intron 1
OTTHUMT00000336408 ; IHH-001; intron 1
OTTHUMT00000336408 ; IHH-001; intron 1
ENST00000295731 ; IHH-001; intron 1
ENST00000295731 ; IHH-001; intron 1
ENST00000295731 ; IHH-001; intron 1
Database links

Mature sequence hsa-miR-3131

Accession MIMAT0014996
Sequence

4 -  

ucgaggacugguggaagggccuu

 - 26

Get sequence
Deep sequencing 95 reads, 5 experiments
Evidence experimental; Solexa [1-2]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).