Stem-loop sequence hsa-mir-3129

Accession MI0014146
Description Homo sapiens miR-3129 stem-loop
Gene family MIPF0001458; mir-3129
Stem-loop 
gua                            ccu   a 
   cuugggcaguaguguagagauugguuug   guu a
   ||||||||||||||||||||||||||||   |||  
   gaacccgucgucacaucucuaaucaaac   uaa u
cga                            --u   g
Get sequence
Deep sequencing
70 reads, 12 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr2: 189997762-189997837 [-]
sense
OTTHUMT00000313523 ; COL5A2-001; intron 1
OTTHUMT00000313523 ; COL5A2-001; intron 1
OTTHUMT00000313523 ; COL5A2-001; intron 1
ENST00000374866 ; COL5A2-001; intron 1
ENST00000374866 ; COL5A2-001; intron 1
ENST00000374866 ; COL5A2-001; intron 1
Database links

Mature sequence hsa-miR-3129-5p

Accession MIMAT0014992
Previous IDs hsa-miR-3129
Sequence

9 -  

gcaguaguguagagauugguuu

 - 30

Get sequence
Deep sequencing 63 reads, 10 experiments
Evidence experimental; Solexa [1-3]
Predicted targets

Mature sequence hsa-miR-3129-3p

Accession MIMAT0019202
Sequence

47 -  

aaacuaaucucuacacugcugc

 - 68

Get sequence
Deep sequencing 7 reads, 3 experiments
Evidence experimental; Solexa [3]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
3
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).