Stem-loop sequence hsa-mir-3128

Accession

MI0014145

Description

Homo sapiens miR-3128 stem-loop

Stem-loop

u    cug                      cc 
 uccu   gcaaguaaaaaacucucauuuu  u
 ||||   ||||||||||||||||||||||   
 agga   cguucauuuuuugagaguaaaa  u
a    uaa                      aa 

Deep sequencing

19 reads, 7 experiments

Genome context

• Coordinates (GRCh37.p5): chr2: 178120673-178120738 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000257753 ; NFE2L2-002; intron 1

  OTTHUMT00000257752 ; NFE2L2-001; intron 1

  OTTHUMT00000334263 ; NFE2L2-008; intron 1

  OTTHUMT00000334267 ; NFE2L2-012; intron 1

  OTTHUMT00000340010 ; NFE2L2-013; intron 1

  OTTHUMT00000334265 ; NFE2L2-010; intron 1

  OTTHUMT00000334264 ; NFE2L2-009; intron 1

  OTTHUMT00000334261 ; NFE2L2-006; intron 1

  OTTHUMT00000334262 ; NFE2L2-007; intron 1

  OTTHUMT00000334266 ; NFE2L2-011; intron 1

  OTTHUMT00000257753 ; NFE2L2-002; intron 1

  OTTHUMT00000257752 ; NFE2L2-001; intron 1

  OTTHUMT00000334263 ; NFE2L2-008; intron 1

  OTTHUMT00000334267 ; NFE2L2-012; intron 1

  OTTHUMT00000340010 ; NFE2L2-013; intron 1

  OTTHUMT00000334265 ; NFE2L2-010; intron 1

  OTTHUMT00000334264 ; NFE2L2-009; intron 1

  OTTHUMT00000334261 ; NFE2L2-006; intron 1

  OTTHUMT00000334262 ; NFE2L2-007; intron 1

  OTTHUMT00000334266 ; NFE2L2-011; intron 1

  OTTHUMT00000257753 ; NFE2L2-002; intron 1

  OTTHUMT00000257752 ; NFE2L2-001; intron 1

  OTTHUMT00000334263 ; NFE2L2-008; intron 1

  OTTHUMT00000334267 ; NFE2L2-012; intron 1

  OTTHUMT00000340010 ; NFE2L2-013; intron 1

  OTTHUMT00000334265 ; NFE2L2-010; intron 1

  OTTHUMT00000334264 ; NFE2L2-009; intron 1

  OTTHUMT00000334261 ; NFE2L2-006; intron 1

  OTTHUMT00000334262 ; NFE2L2-007; intron 1

  OTTHUMT00000334266 ; NFE2L2-011; intron 1

  OTTHUMT00000257754 ; NFE2L2-003; intron 4

  OTTHUMT00000257754 ; NFE2L2-003; intron 4

  OTTHUMT00000257754 ; NFE2L2-003; intron 4

  ENST00000397063 ; NFE2L2-002; intron 1

  ENST00000397062 ; NFE2L2-001; intron 1

  ENST00000446151 ; NFE2L2-008; intron 1

  ENST00000449627 ; NFE2L2-012; intron 1

  ENST00000448782 ; NFE2L2-013; intron 1

  ENST00000430047 ; NFE2L2-010; intron 1

  ENST00000421929 ; NFE2L2-009; intron 1

  ENST00000423513 ; NFE2L2-006; intron 1

  ENST00000477534 ; NFE2L2-007; intron 1

  ENST00000462023 ; NFE2L2-011; intron 1

  ENST00000397063 ; NFE2L2-002; intron 1

  ENST00000397062 ; NFE2L2-001; intron 1

  ENST00000446151 ; NFE2L2-008; intron 1

  ENST00000449627 ; NFE2L2-012; intron 1

  ENST00000448782 ; NFE2L2-013; intron 1

  ENST00000430047 ; NFE2L2-010; intron 1

  ENST00000421929 ; NFE2L2-009; intron 1

  ENST00000423513 ; NFE2L2-006; intron 1

  ENST00000477534 ; NFE2L2-007; intron 1

  ENST00000462023 ; NFE2L2-011; intron 1

  ENST00000397063 ; NFE2L2-002; intron 1

  ENST00000397062 ; NFE2L2-001; intron 1

  ENST00000446151 ; NFE2L2-008; intron 1

  ENST00000449627 ; NFE2L2-012; intron 1

  ENST00000448782 ; NFE2L2-013; intron 1

  ENST00000430047 ; NFE2L2-010; intron 1

  ENST00000421929 ; NFE2L2-009; intron 1

  ENST00000423513 ; NFE2L2-006; intron 1

  ENST00000477534 ; NFE2L2-007; intron 1

  ENST00000462023 ; NFE2L2-011; intron 1

  ENST00000464747 ; NFE2L2-003; intron 4

  ENST00000464747 ; NFE2L2-003; intron 4

  ENST00000464747 ; NFE2L2-003; intron 4

Database links

• ENTREZGENE: 100422824;MIR3128

Mature sequence hsa-miR-3128

• Accession: MIMAT0014991
• Sequence: 5 - ucuggcaaguaaaaaacucucau - 27
• Deep sequencing: 19 reads, 7 experiments
• Evidence: experimental; Solexa [1-2]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-3128
  • MICRORNA.ORG:hsa-miR-3128
  • MIRDB:hsa-miR-3128
  • RNA22-HSA:hsa-miR-3128
  • TARGETMINER:hsa-miR-3128

References

1. PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).