Stem-loop sequence hsa-mir-3127

Accession MI0014144
Description Homo sapiens miR-3127 stem-loop
Gene family MIPF0001439; mir-3127
Stem-loop 
     g     uca       ug   u      - aga 
ggcca gccca   gggcuug  gaa gggaag g   a
||||| |||||   |||||||  ||| |||||| |    
ucggu ugggu   uccggac  cuu cccuuc c   g
     g     -cg       gu   c      g agg
Get sequence
Deep sequencing
182 reads, 14 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr2: 97464015-97464090 [+]
sense
OTTHUMT00000252954 ; CNNM4-001; intron 3
OTTHUMT00000339074 ; CNNM4-003; intron 3
OTTHUMT00000339075 ; CNNM4-004; intron 3
OTTHUMT00000252954 ; CNNM4-001; intron 3
OTTHUMT00000339074 ; CNNM4-003; intron 3
OTTHUMT00000339075 ; CNNM4-004; intron 3
OTTHUMT00000252954 ; CNNM4-001; intron 3
OTTHUMT00000339074 ; CNNM4-003; intron 3
OTTHUMT00000339075 ; CNNM4-004; intron 3
ENST00000377075 ; CNNM4-001; intron 3
ENST00000496186 ; CNNM4-003; intron 3
ENST00000493384 ; CNNM4-004; intron 3
ENST00000540067 ; CNNM4-201; intron 3
ENST00000377075 ; CNNM4-001; intron 3
ENST00000496186 ; CNNM4-003; intron 3
ENST00000493384 ; CNNM4-004; intron 3
ENST00000540067 ; CNNM4-201; intron 3
ENST00000377075 ; CNNM4-001; intron 3
ENST00000496186 ; CNNM4-003; intron 3
ENST00000493384 ; CNNM4-004; intron 3
ENST00000540067 ; CNNM4-201; intron 3
Database links

Mature sequence hsa-miR-3127-5p

Accession MIMAT0014990
Previous IDs hsa-miR-3127
Sequence

11 -  

aucagggcuuguggaaugggaag

 - 33

Get sequence
Deep sequencing 180 reads, 12 experiments
Evidence experimental; Solexa [1-2]
Predicted targets

Mature sequence hsa-miR-3127-3p

Accession MIMAT0019201
Sequence

47 -  

uccccuucugcaggccugcugg

 - 68

Get sequence
Evidence experimental; Solexa [2]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).