Stem-loop sequence hsa-mir-3125

Accession MI0014142
Description Homo sapiens miR-3125 stem-loop
Stem-loop 
   aau   ua       c  u   --ga    u       
gag   ggg  gaggaag ug gga    gaac cacggu 
|||   |||  ||||||| || |||    |||| ||||| g
cuc   ucc  cuccuuc gc ccu    cuug gugucc 
   cuu   uc       c  c   agag    -
Get sequence
Deep sequencing
14 reads, 6 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr2: 12877493-12877570 [+]
sense
OTTHUMT00000207114 ; TRIB2-001; intron 2
OTTHUMT00000280497 ; TRIB2-002; intron 2
OTTHUMT00000207114 ; TRIB2-001; intron 2
OTTHUMT00000280497 ; TRIB2-002; intron 2
OTTHUMT00000207114 ; TRIB2-001; intron 2
OTTHUMT00000280497 ; TRIB2-002; intron 2
ENST00000155926 ; TRIB2-001; intron 2
ENST00000381465 ; TRIB2-002; intron 2
ENST00000155926 ; TRIB2-001; intron 2
ENST00000381465 ; TRIB2-002; intron 2
ENST00000155926 ; TRIB2-001; intron 2
ENST00000381465 ; TRIB2-002; intron 2
Database links

Mature sequence hsa-miR-3125

Accession MIMAT0014988
Sequence

10 -  

uagaggaagcuguggagaga

 - 29

Get sequence
Deep sequencing 14 reads, 6 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).