Stem-loop sequence hsa-mir-3124

Accession MI0014140
Description Homo sapiens miR-3124 stem-loop
Stem-loop 
  g           c -a   c      g    c 
gc ggcuucgcggg g  agg aaaguc auuu c
|| ||||||||||| |  ||| |||||| ||||  
cg cugaagugccc c  ucc uuucag ugaa a
  g           u ac   -      -    a
Get sequence
Deep sequencing
42 reads, 8 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr1: 249120576-249120642 [+]
antisense
OTTHUMT00000097140 ; SH3BP5L-001; 5'UTR (exon 1)
OTTHUMT00000097140 ; SH3BP5L-001; 5'UTR (exon 1)
OTTHUMT00000097140 ; SH3BP5L-001; 5'UTR (exon 1)
ENST00000366472 ; SH3BP5L-001; 5'UTR (exon 1)
ENST00000366472 ; SH3BP5L-001; 5'UTR (exon 1)
ENST00000366472 ; SH3BP5L-001; 5'UTR (exon 1)
Database links

Mature sequence hsa-miR-3124-5p

Accession MIMAT0014986
Previous IDs hsa-miR-3124
Sequence

7 -  

uucgcgggcgaaggcaaaguc

 - 27

Get sequence
Deep sequencing 42 reads, 8 experiments
Evidence experimental; Solexa [1-3]
Predicted targets

Mature sequence hsa-miR-3124-3p

Accession MIMAT0019200
Sequence

42 -  

acuuuccucacucccgugaagu

 - 63

Get sequence
Evidence experimental; Solexa [3]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
3
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).