Stem-loop sequence hsa-mir-3122

Accession MI0014138
Description Homo sapiens miR-3122 stem-loop
Gene family MIPF0001549; mir-3122
Stem-loop 
         g  g        g  c         u 
accagcucu uu ggacaaga ga ggucuucuu u
||||||||| || |||||||| || ||||||||| g
uggucgaga aa ccuguucu cu ccagaagga g
         g  g        a  a         a
Get sequence
Deep sequencing
11 reads, 4 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr1: 212250955-212251027 [+]
sense
OTTHUMT00000090184 ; DTL-003; intron 1
OTTHUMT00000090184 ; DTL-003; intron 1
OTTHUMT00000090184 ; DTL-003; intron 1
OTTHUMT00000090183 ; DTL-002; intron 9
OTTHUMT00000090183 ; DTL-002; intron 9
OTTHUMT00000090183 ; DTL-002; intron 9
OTTHUMT00000090182 ; DTL-001; intron 11
OTTHUMT00000090182 ; DTL-001; intron 11
OTTHUMT00000090182 ; DTL-001; intron 11
ENST00000489149 ; DTL-003; intron 1
ENST00000489149 ; DTL-003; intron 1
ENST00000489149 ; DTL-003; intron 1
ENST00000420235 ; DTL-201; intron 2
ENST00000420235 ; DTL-201; intron 2
ENST00000475419 ; DTL-002; intron 9
ENST00000475419 ; DTL-002; intron 9
ENST00000475419 ; DTL-002; intron 9
ENST00000542077 ; DTL-202; intron 10
ENST00000542077 ; DTL-202; intron 10
ENST00000542077 ; DTL-201; intron 10
ENST00000366991 ; DTL-001; intron 11
ENST00000366991 ; DTL-001; intron 11
ENST00000366991 ; DTL-001; intron 11
Database links

Mature sequence hsa-miR-3122

Accession MIMAT0014984
Sequence

10 -  

guugggacaagaggacggucuu

 - 31

Get sequence
Deep sequencing 10 reads, 3 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).