Stem-loop sequence hsa-mir-3121

Accession MI0014137
Description Homo sapiens miR-3121 stem-loop
Gene family MIPF0001417; mir-3121
Stem-loop 
     guua                        --  a 
aaaug    uguccuuugccuauucuauuuaag  ac c
|||||    ||||||||||||||||||||||||  || c
uuuac    acaggaaacggaugagauaaauuc  ug c
     aaag                        ca  u
Get sequence
Deep sequencing
30 reads, 9 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr1: 180407449-180407525 [-]
sense
OTTHUMT00000084998 ; ACBD6-001; intron 3
OTTHUMT00000084998 ; ACBD6-001; intron 3
OTTHUMT00000084998 ; ACBD6-001; intron 3
ENST00000367595 ; ACBD6-001; intron 3
ENST00000367595 ; ACBD6-001; intron 3
ENST00000367595 ; ACBD6-001; intron 3
Database links

Mature sequence hsa-miR-3121-5p

Accession MIMAT0019199
Sequence

12 -  

uccuuugccuauucuauuuaag

 - 33

Get sequence
Evidence experimental; Solexa [3]
Predicted targets

Mature sequence hsa-miR-3121-3p

Accession MIMAT0014983
Previous IDs hsa-miR-3121
Sequence

47 -  

uaaauagaguaggcaaaggaca

 - 68

Get sequence
Deep sequencing 30 reads, 9 experiments
Evidence experimental; Solexa [1-3]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
3
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).