|
miRBase |
|
Stem-loop sequence hsa-mir-3121 |
|||||
| Accession | MI0014137 | ||||
| Description | Homo sapiens miR-3121 stem-loop | ||||
| Gene family | MIPF0001417; mir-3121 | ||||
| Stem-loop |
guua -- a aaaug uguccuuugccuauucuauuuaag ac c ||||| |||||||||||||||||||||||| || c uuuac acaggaaacggaugagauaaauuc ug c aaag ca u |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-3121-5p |
|
| Accession | MIMAT0019199 |
| Sequence |
12 - uccuuugccuauucuauuuaag - 33 |
| Evidence | experimental; Solexa [3] |
| Predicted targets |
|
Mature sequence hsa-miR-3121-3p |
|
| Accession | MIMAT0014983 |
| Previous IDs | hsa-miR-3121 |
| Sequence |
47 - uaaauagaguaggcaaaggaca - 68 |
| Deep sequencing | 30 reads, 9 experiments |
| Evidence | experimental; Solexa [1-3] |
| Predicted targets |
|
References |
|
| 1 |
PMID:20300190
"Characterization of the Melanoma miRNAome by Deep Sequencing"
PLoS One. 5:e9685(2010).
|
| 2 |
PMID:20224791
"Discovery of novel microRNAs in female reproductive tract using next generation sequencing"
PLoS One. 5:e9637(2010).
|
| 3 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|