Stem-loop sequence hsa-mir-3120

Accession

MI0014136

Description

Homo sapiens miR-3120 stem-loop

Gene family

MIPF0000062; mir-214

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MiR-214. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

miR-214 is a family of microRNA precursors found in animals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference.

Stem-loop

        a           ug c      a    ugag 
gucaugug cugccugucug  c ugcugu cagg    c
|||||||| |||||||||||  | |||||| ||||    g
caguacac gacggacagau  g acgaca gucu    g
        a           gu a      c    ugua 

Deep sequencing

9 reads, 3 experiments

Genome context

• Coordinates (GRCh37.p5): chr1: 172107948-172108028 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000378444 ; DNM3-008; intron 13

  OTTHUMT00000378444 ; DNM3-008; intron 13

  OTTHUMT00000378444 ; DNM3-008; intron 13

  OTTHUMT00000084529 ; DNM3-001; intron 14

  OTTHUMT00000378443 ; DNM3-007; intron 14

  OTTHUMT00000084529 ; DNM3-001; intron 14

  OTTHUMT00000378443 ; DNM3-007; intron 14

  OTTHUMT00000084529 ; DNM3-001; intron 14

  OTTHUMT00000378443 ; DNM3-007; intron 14

  OTTHUMT00000084531 ; DNM3-003; intron 15

  OTTHUMT00000084531 ; DNM3-003; intron 15

  OTTHUMT00000084531 ; DNM3-003; intron 15

  ENST00000523513 ; DNM3-008; intron 13

  ENST00000523513 ; DNM3-008; intron 13

  ENST00000523513 ; DNM3-008; intron 13

  ENST00000367731 ; DNM3-001; intron 14

  ENST00000520906 ; DNM3-007; intron 14

  ENST00000358155 ; DNM3-201; intron 14

  ENST00000367731 ; DNM3-001; intron 14

  ENST00000520906 ; DNM3-007; intron 14

  ENST00000358155 ; DNM3-201; intron 14

  ENST00000367731 ; DNM3-001; intron 14

  ENST00000520906 ; DNM3-007; intron 14

  ENST00000358155 ; DNM3-201; intron 14

  ENST00000355305 ; DNM3-003; intron 15

  ENST00000359070 ; DNM3-202; intron 15

  ENST00000355305 ; DNM3-003; intron 15

  ENST00000359070 ; DNM3-202; intron 15

  ENST00000355305 ; DNM3-003; intron 15

  antisense

  ENST00000385214 ; MIR214-201; exon 1

  ENST00000385214 ; MIR214-201; exon 1

  ENST00000385214 ; MIR214-201; exon 1

Clustered miRNAs

< 10kb from hsa-mir-3120

• hsa-mir-214: chr1: 172107938-172108047 [-]
• hsa-mir-3120: chr1: 172107948-172108028 [+]
• hsa-mir-199a-2: chr1: 172113675-172113784 [-]

Database links

• ENTREZGENE: 100422882;MIR3120

Mature sequence hsa-miR-3120-5p

• Accession: MIMAT0019198
• Sequence: 13 - ccugucugugccugcuguaca - 33
• Evidence: experimental; Solexa [2]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-3120-5p
  • MIRDB:hsa-miR-3120-5p
  • TARGETMINER:hsa-miR-3120-5p

Mature sequence hsa-miR-3120-3p

• Accession: MIMAT0014982
• Previous IDs: hsa-miR-3120
• Sequence: 51 - cacagcaaguguagacaggca - 71
• Deep sequencing: 9 reads, 3 experiments
• Evidence: experimental; Solexa [1-2]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-3120-3p
  • MICRORNA.ORG:hsa-miR-3120-3p
  • MIRDB:hsa-miR-3120-3p
  • RNA22-HSA:hsa-miR-3120-3p
  • TARGETMINER:hsa-miR-3120-3p

References

1. PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).