Stem-loop sequence hsa-mir-3119-2

Accession MI0014135
Description Homo sapiens miR-3119-2 stem-loop
Gene family MIPF0000971; mir-3119
Stem-loop
       a                        aca   auu 
auuaacu uggcuuuuaacuuugauggcaaag   uag   g
||||||| ||||||||||||||||||||||||   |||   u
uaauuga accgaaaauugaaacuaccguuuc   auc   u
       g                        ccc   gau 
Get sequence
Deep sequencing
6 reads, 3 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr1: 170120519-170120603 [+]
sense
OTTHUMT00000087586 ; METTL11B-001; intron 1
OTTHUMT00000087586 ; METTL11B-001; intron 1
OTTHUMT00000087586 ; METTL11B-001; intron 1
ENST00000439373 ; METTL11B-001; intron 1
ENST00000439373 ; METTL11B-001; intron 1
ENST00000439373 ; METTL11B-001; intron 1
Clustered miRNAs
< 10kb from hsa-mir-3119-2
hsa-mir-3119-2 chr1: 170120519-170120603 [+]
hsa-mir-3119-1 chr1: 170120519-170120603 [-]
Database links

Mature sequence hsa-miR-3119

Accession MIMAT0014981
Sequence

9 - 

uggcuuuuaacuuugauggc

 - 28

Get sequence
Deep sequencing 11 reads, 3 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).